Search our product database

Search options:
Product name: hCDC73 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03710-1
Sigma Product ID: EHU037101
Species: Homo sapiens
Ensembl Gene ID: ENSG00000134371
Ensembl Transcript ID: ENST00000367435, ENST00000635846, ENST00000643006, ENST00000643784, ENST00000647662, ENST00000648071, ENST00000649606, ENST00000649895, ENST00000650099, ENST00000650197
Gene coordinates (GRCh38): 1:193121800-193254815
HGNC Alias: C1orf28, FIHP, HRPT1, HRPT2, parafibromin
HGNC ID: HGNC:16783
HGNC Symbol: CDC73
NCBI gene: 79577
RefSeq mRNA: NM_024529
Sequence:AACGTGCACCTTTCTCATCCTGTTTATGTCCGACGTGCAGCTACTGAAAATATTC
CTGTGGTTAGAAGACCTGATCGAAAAGATCTACTTGGATATCTCAATGGTGAAGC
GTCAACATCGGCAAGTATAGACAGAAGCGCTCCCTTAGAAATAGGTCTTCAGCGA
TCTACTCAAGTCAAACGAGCTGCAGATGAAGTTTTAGCAGAAGCAAAGAAACCAC
GAATTGAGGATGAAGAGTGTGTGCGCCTTGATAAAGAGAGATTGGCTGCCCGTTT
GGAGGGTCACAAAGAAGGGATTGTACAGACTGAACAGATTAGGTCTTTGTCTGAA
GCTATGTCAGTGGAAAAAATTGCTGCAATCAAAGCCAAAATTATGGCTAAGAAAA
GATCTACTATCAAGACTGATCTAGATGATGACATAACTGCCCTTAAACAGAGGAG
TTTTGTGGATGCTGAGGTAGATGTGACCCG
Product name: hCDC73 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-03710-1
Sigma Product ID: EHU037101
Species: Homo sapiens
Ensembl Gene ID: ENSG00000134371
Ensembl Transcript ID: ENST00000367435, ENST00000635846, ENST00000643006, ENST00000643784, ENST00000647662, ENST00000648071, ENST00000649606, ENST00000649895, ENST00000650099, ENST00000650197
Gene coordinates (GRCh38): 1:193121800-193254815
HGNC Alias: C1orf28, FIHP, HRPT1, HRPT2, parafibromin
HGNC ID: HGNC:16783
HGNC Symbol: CDC73
NCBI gene: 79577
RefSeq mRNA: NM_024529
Sequence:AACGTGCACCTTTCTCATCCTGTTTATGTCCGACGTGCAGCTACTGAAAATATTC
CTGTGGTTAGAAGACCTGATCGAAAAGATCTACTTGGATATCTCAATGGTGAAGC
GTCAACATCGGCAAGTATAGACAGAAGCGCTCCCTTAGAAATAGGTCTTCAGCGA
TCTACTCAAGTCAAACGAGCTGCAGATGAAGTTTTAGCAGAAGCAAAGAAACCAC
GAATTGAGGATGAAGAGTGTGTGCGCCTTGATAAAGAGAGATTGGCTGCCCGTTT
GGAGGGTCACAAAGAAGGGATTGTACAGACTGAACAGATTAGGTCTTTGTCTGAA
GCTATGTCAGTGGAAAAAATTGCTGCAATCAAAGCCAAAATTATGGCTAAGAAAA
GATCTACTATCAAGACTGATCTAGATGATGACATAACTGCCCTTAAACAGAGGAG
TTTTGTGGATGCTGAGGTAGATGTGACCCG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.