Search our product database

Search options:
Product name: hUHRF1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04050-1
Sigma Product ID: EHU040501
Species: Homo sapiens
Ensembl Gene ID: ENSG00000256663, ENSG00000276043
Ensembl Transcript ID: ENST00000540175, ENST00000612630, ENST00000613817, ENST00000615884, ENST00000616255, ENST00000620565, ENST00000622802, ENST00000624301
Gene coordinates (GRCh38): 12:20551590-20553012, 19:4903080-4962154
HGNC Alias: FLJ21925, ICBP90, Np95, RNF106, TDRD22
HGNC ID: HGNC:12556
HGNC Symbol: UHRF1
NCBI gene: 29128
RefSeq mRNA: NM_001048201, NM_001290050, NM_001290051, NM_001290052, NM_013282
Sequence:TGTGGACCATGGGAATTTTTTCACATACACGGGTAGTGGTGGTCGAGATCTTTCC
GGCAACAAGAGGACCGCGGAACAGTCTTGTGATCAGAAACTCACCAACACCAACA
GGGCGCTGGCTCTCAACTGCTTTGCTCCCATCAATGACCAAGAAGGGGCCGAGGC
CAAGGACTGGCGGTCGGGGAAGCCGGTCAGGGTGGTGCGCAATGTCAAGGGTGGC
AAGAATAGCAAGTACGCCCCCGCTGAGGGCAACCGCTACGATGGCATCTACAAGG
TTGTGAAATACTGGCCCGAGAAGGGGAAGTCCGGGTTTCTCGTGTGGCGCTACCT
TCTGCGGAGGGACGATGATGAGCCTGGCCCTTGGACGAAGGAGGGGAAGGACCGG
ATCAAGAAGCTGGGGCTGACCATGCAGTATCCAGAAGGCTACCTGGAAGCCCTGG
CCAACCGAGAGCGAGAGAAGGAGAA
Product name: hUHRF1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04050-1
Sigma Product ID: EHU040501
Species: Homo sapiens
Ensembl Gene ID: ENSG00000256663, ENSG00000276043
Ensembl Transcript ID: ENST00000540175, ENST00000612630, ENST00000613817, ENST00000615884, ENST00000616255, ENST00000620565, ENST00000622802, ENST00000624301
Gene coordinates (GRCh38): 12:20551590-20553012, 19:4903080-4962154
HGNC Alias: FLJ21925, ICBP90, Np95, RNF106, TDRD22
HGNC ID: HGNC:12556
HGNC Symbol: UHRF1
NCBI gene: 29128
RefSeq mRNA: NM_001048201, NM_001290050, NM_001290051, NM_001290052, NM_013282
Sequence:TGTGGACCATGGGAATTTTTTCACATACACGGGTAGTGGTGGTCGAGATCTTTCC
GGCAACAAGAGGACCGCGGAACAGTCTTGTGATCAGAAACTCACCAACACCAACA
GGGCGCTGGCTCTCAACTGCTTTGCTCCCATCAATGACCAAGAAGGGGCCGAGGC
CAAGGACTGGCGGTCGGGGAAGCCGGTCAGGGTGGTGCGCAATGTCAAGGGTGGC
AAGAATAGCAAGTACGCCCCCGCTGAGGGCAACCGCTACGATGGCATCTACAAGG
TTGTGAAATACTGGCCCGAGAAGGGGAAGTCCGGGTTTCTCGTGTGGCGCTACCT
TCTGCGGAGGGACGATGATGAGCCTGGCCCTTGGACGAAGGAGGGGAAGGACCGG
ATCAAGAAGCTGGGGCTGACCATGCAGTATCCAGAAGGCTACCTGGAAGCCCTGG
CCAACCGAGAGCGAGAGAAGGAGAA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.