Search our product database

Search options:
Product name: hCETN3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04058-1
Sigma Product ID: EHU040581
Species: Homo sapiens
Ensembl Gene ID: ENSG00000153140
Ensembl Transcript ID: ENST00000283122, ENST00000522083, ENST00000522565, ENST00000522864
Gene coordinates (GRCh38): 5:90392261-90409786
HGNC Alias: CEN3
HGNC ID: HGNC:1868
HGNC Symbol: CETN3
NCBI gene: 1070
RefSeq mRNA: NM_001297765, NM_001297768, NM_004365
Sequence:AGGAACGTCTCTGTGCGAAGAGATAATGAGTTTAGCTCTGAGAAGTGAGCTTGTA
GTGGACAAAACAAAGAGGAAAAAAAGAAGAGAACTGTCTGAGGAACAGAAACAAG
AAATTAAAGATGCTTTTGAACTATTTGATACAGACAAAGATGAAGCAATAGATTA
TCATGAATTAAAGGTGGCAATGAGAGCCTTGGGGTTTGATGTAAAAAAAGCTGAT
GTACTGAAGATTCTTAAAGATTATGACAGAGAAGCCACAGGGAAAATCACCTTTG
AAGATTTTAATGAAGTTGTGACAGACTGGATATTGGAAAGAGATCCCCATGAAGA
AATACTCAAGGCATTTAAACTATTTGATGATGATGATTCAGGTAAAATAAGCTTG
AGGAATTTGCGACGTGTTGCTA
Product name: hCETN3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04058-1
Sigma Product ID: EHU040581
Species: Homo sapiens
Ensembl Gene ID: ENSG00000153140
Ensembl Transcript ID: ENST00000283122, ENST00000522083, ENST00000522565, ENST00000522864
Gene coordinates (GRCh38): 5:90392261-90409786
HGNC Alias: CEN3
HGNC ID: HGNC:1868
HGNC Symbol: CETN3
NCBI gene: 1070
RefSeq mRNA: NM_001297765, NM_001297768, NM_004365
Sequence:AGGAACGTCTCTGTGCGAAGAGATAATGAGTTTAGCTCTGAGAAGTGAGCTTGTA
GTGGACAAAACAAAGAGGAAAAAAAGAAGAGAACTGTCTGAGGAACAGAAACAAG
AAATTAAAGATGCTTTTGAACTATTTGATACAGACAAAGATGAAGCAATAGATTA
TCATGAATTAAAGGTGGCAATGAGAGCCTTGGGGTTTGATGTAAAAAAAGCTGAT
GTACTGAAGATTCTTAAAGATTATGACAGAGAAGCCACAGGGAAAATCACCTTTG
AAGATTTTAATGAAGTTGTGACAGACTGGATATTGGAAAGAGATCCCCATGAAGA
AATACTCAAGGCATTTAAACTATTTGATGATGATGATTCAGGTAAAATAAGCTTG
AGGAATTTGCGACGTGTTGCTA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.