Search our product database

Search options:
Product name: hGSK3A €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04079-1
Sigma Product ID: EHU040791
Species: Homo sapiens
Ensembl Gene ID: ENSG00000105723
Ensembl Transcript ID: ENST00000222330, ENST00000398249, ENST00000453535
Gene coordinates (GRCh38): 19:42230186-42242625
HGNC ID: HGNC:4616
HGNC Symbol: GSK3A
NCBI gene: 2931
RefSeq mRNA: NM_019884
Sequence:GGTTCAAGAACCGAGAGCTGCAGATCATGCGTAAGCTGGACCACTGCAATATTGT
GAGGCTGAGATACTTTTTCTACTCCAGTGGCGAGAAGAAAGACGAGCTTTACCTA
AATCTGGTGCTGGAATATGTGCCCGAGACAGTGTACCGGGTGGCCCGCCACTTCA
CCAAGGCCAAGTTGACCATCCCTATCCTCTATGTCAAGGTGTACATGTACCAGCT
CTTCCGCAGCTTGGCCTACATCCACTCCCAGGGCGTGTGTCACCGCGACATCAAG
CCCCAGAACCTGCTGGTGGACCCTGACACTGCTGTCCTCAAGCTCTGCGATTTTG
GCAGTGCAAAGCAGTTGGTCCGAGGGGAGCCCAATGTCTCCTACATCTGTTCTCG
CTACTACCGGGCCCCAGAGCTCATCTTTGGAGCCACTGATTACACCTCATCCATC
GATGTTTGGTCAGCTGGCTGTGTAC
Product name: hGSK3A €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04079-1
Sigma Product ID: EHU040791
Species: Homo sapiens
Ensembl Gene ID: ENSG00000105723
Ensembl Transcript ID: ENST00000222330, ENST00000398249, ENST00000453535
Gene coordinates (GRCh38): 19:42230186-42242625
HGNC ID: HGNC:4616
HGNC Symbol: GSK3A
NCBI gene: 2931
RefSeq mRNA: NM_019884
Sequence:GGTTCAAGAACCGAGAGCTGCAGATCATGCGTAAGCTGGACCACTGCAATATTGT
GAGGCTGAGATACTTTTTCTACTCCAGTGGCGAGAAGAAAGACGAGCTTTACCTA
AATCTGGTGCTGGAATATGTGCCCGAGACAGTGTACCGGGTGGCCCGCCACTTCA
CCAAGGCCAAGTTGACCATCCCTATCCTCTATGTCAAGGTGTACATGTACCAGCT
CTTCCGCAGCTTGGCCTACATCCACTCCCAGGGCGTGTGTCACCGCGACATCAAG
CCCCAGAACCTGCTGGTGGACCCTGACACTGCTGTCCTCAAGCTCTGCGATTTTG
GCAGTGCAAAGCAGTTGGTCCGAGGGGAGCCCAATGTCTCCTACATCTGTTCTCG
CTACTACCGGGCCCCAGAGCTCATCTTTGGAGCCACTGATTACACCTCATCCATC
GATGTTTGGTCAGCTGGCTGTGTAC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.