Search our product database

Search options:
Product name: hKIF2A €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04215-1
Sigma Product ID: EHU042151
Species: Homo sapiens
Ensembl Gene ID: ENSG00000068796
Ensembl Transcript ID: ENST00000381103, ENST00000401507, ENST00000407818, ENST00000506857
Gene coordinates (GRCh38): 5:62306162-62537249
HGNC Alias: HK2, KIF2
HGNC ID: HGNC:6318
HGNC Symbol: KIF2A
NCBI gene: 3796
RefSeq mRNA: NM_001098511, NM_001243952, NM_001243953, NM_004520
Sequence:CAGGTTCAAGTGGTGGGATTACAGGAACGGGAGGTCAAATGTGTTGAAGATGTAC
TGAAACTCATTGACATAGGCAACAGTTGCAGAACATCCGGTCAAACATCTGCAAA
TGCACATTCATCTCGGAGCCATGCAGTGTTTCAGATTATTCTTAGAAGGAAAGGA
AAACTACATGGCAAATTTTCTCTCATTGATTTGGCTGGAAATGAAAGAGGAGCTG
ATACTTCCAGTGCGGACAGGCAAACTAGGCTTGAAGGTGCTGAAATTAATAAAAG
CCTTTTAGCACTCAAGGAGTGCATCAGAGCCTTAGGTAGAAATAAACCTCATACT
CCTTTCCGTGCAAGTAAACTCACTCAGGTGTTAAGAGATTCTTTCATAGGTGAAA
ACTCTCGTACCTGCATGATTGC
Product name: hKIF2A €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04215-1
Sigma Product ID: EHU042151
Species: Homo sapiens
Ensembl Gene ID: ENSG00000068796
Ensembl Transcript ID: ENST00000381103, ENST00000401507, ENST00000407818, ENST00000506857
Gene coordinates (GRCh38): 5:62306162-62537249
HGNC Alias: HK2, KIF2
HGNC ID: HGNC:6318
HGNC Symbol: KIF2A
NCBI gene: 3796
RefSeq mRNA: NM_001098511, NM_001243952, NM_001243953, NM_004520
Sequence:CAGGTTCAAGTGGTGGGATTACAGGAACGGGAGGTCAAATGTGTTGAAGATGTAC
TGAAACTCATTGACATAGGCAACAGTTGCAGAACATCCGGTCAAACATCTGCAAA
TGCACATTCATCTCGGAGCCATGCAGTGTTTCAGATTATTCTTAGAAGGAAAGGA
AAACTACATGGCAAATTTTCTCTCATTGATTTGGCTGGAAATGAAAGAGGAGCTG
ATACTTCCAGTGCGGACAGGCAAACTAGGCTTGAAGGTGCTGAAATTAATAAAAG
CCTTTTAGCACTCAAGGAGTGCATCAGAGCCTTAGGTAGAAATAAACCTCATACT
CCTTTCCGTGCAAGTAAACTCACTCAGGTGTTAAGAGATTCTTTCATAGGTGAAA
ACTCTCGTACCTGCATGATTGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.