Search our product database

Search options:
Product name: hMAP6D1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04359-1
Sigma Product ID: EHU043591
Species: Homo sapiens
Ensembl Gene ID: ENSG00000180834, ENSG00000283765
Ensembl Transcript ID: ENST00000318631, ENST00000639401
Gene coordinates (GRCh38): 3:183815568-183884889, 3:183815876-183825594
HGNC Alias: FLJ12748, SL21
HGNC ID: HGNC:25753
HGNC Symbol: MAP6D1
NCBI gene: 55486, 79929
RefSeq mRNA: NM_024871
Sequence:CGAGTCATCACAACCCACACTTCGGGATGGGACAGCAGCCCTGGGGCCGGCTTCC
AGGTCCCAGAGGTGAGGAAGAAGTTCACTCCTAACCCCTCCGCCATCTTTCAGGC
CTCAGCTCCCCGGATTCTCAACGTGTGACTGCCTGCACCGTGACACCATGGCTGC
CGACAGGACAGGGCTGGGGAGCGGCCTCAGGACCCACTGCCGCGGGGCTGGGCGA
GAGCATGGCATGGGCCCCTGCGGGAGGGCACAGCCCCTCTCAAAGCTGTCACCAG
GGCCAAAGTGCTGGTGTGGAGCAGATGCACCGATGGACTTGGCACACCCAGCTCA
GCCTCAAGCATCCTCTTGAGAAGCCTGTGGAAGGCTCCTGCGTTCGTTAACTGCC
ATCTGGCCGTCTCTCAGTTTT
Product name: hMAP6D1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04359-1
Sigma Product ID: EHU043591
Species: Homo sapiens
Ensembl Gene ID: ENSG00000180834, ENSG00000283765
Ensembl Transcript ID: ENST00000318631, ENST00000639401
Gene coordinates (GRCh38): 3:183815568-183884889, 3:183815876-183825594
HGNC Alias: FLJ12748, SL21
HGNC ID: HGNC:25753
HGNC Symbol: MAP6D1
NCBI gene: 55486, 79929
RefSeq mRNA: NM_024871
Sequence:CGAGTCATCACAACCCACACTTCGGGATGGGACAGCAGCCCTGGGGCCGGCTTCC
AGGTCCCAGAGGTGAGGAAGAAGTTCACTCCTAACCCCTCCGCCATCTTTCAGGC
CTCAGCTCCCCGGATTCTCAACGTGTGACTGCCTGCACCGTGACACCATGGCTGC
CGACAGGACAGGGCTGGGGAGCGGCCTCAGGACCCACTGCCGCGGGGCTGGGCGA
GAGCATGGCATGGGCCCCTGCGGGAGGGCACAGCCCCTCTCAAAGCTGTCACCAG
GGCCAAAGTGCTGGTGTGGAGCAGATGCACCGATGGACTTGGCACACCCAGCTCA
GCCTCAAGCATCCTCTTGAGAAGCCTGTGGAAGGCTCCTGCGTTCGTTAACTGCC
ATCTGGCCGTCTCTCAGTTTT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.