Search our product database

Search options:
Product name: hZNF362 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04575-1
Sigma Product ID: EHU045751
Species: Homo sapiens
Ensembl Gene ID: ENSG00000160094
Ensembl Transcript ID: ENST00000373428, ENST00000539719
Gene coordinates (GRCh38): 1:33256545-33300719
HGNC Alias: FLJ25476, lin-29, RN
HGNC ID: HGNC:18079
HGNC Symbol: ZNF362
NCBI gene: 149076
RefSeq mRNA: NM_152493
Sequence:CCTACAAGTGCCCACATCCTGGCTGCGAGAAGGCTTTCACTCAGCTCTCCAACCT
CCAGTCTCACCAGCGCCAGCACAACAAGGACAAGCCCTACAAGTGTCCCAACTGC
TACCGGGCCTATTCGGACTCCGCTTCTTTGCAGATCCACCTCTCGGCCCACGCCA
TCAAGCACGCCAAGGCCTACTGCTGCAGCATGTGTGGGCGGGCCTACACCTCGGA
GACCTACCTGATGAAGCACATGTCCAAACACACGGTGGTGGAGCACCTGGTGAGC
CATCACTCGCCCCAGAGGACGGAGTCCCCCGGCATCCCGGTGCGAATCTCTCTCA
TCTGAGCCCACTGGAGGCGCCGCCCCACCCGGCCCACTGGCAGACACAGACCCAG
GCAGCACCAGGCCCCAGCTCCCTCCGGGGGCCCTCCAGGAACCACCAAGCTCTCT
CACGACCTTCCCAATCTTC
Product name: hZNF362 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04575-1
Sigma Product ID: EHU045751
Species: Homo sapiens
Ensembl Gene ID: ENSG00000160094
Ensembl Transcript ID: ENST00000373428, ENST00000539719
Gene coordinates (GRCh38): 1:33256545-33300719
HGNC Alias: FLJ25476, lin-29, RN
HGNC ID: HGNC:18079
HGNC Symbol: ZNF362
NCBI gene: 149076
RefSeq mRNA: NM_152493
Sequence:CCTACAAGTGCCCACATCCTGGCTGCGAGAAGGCTTTCACTCAGCTCTCCAACCT
CCAGTCTCACCAGCGCCAGCACAACAAGGACAAGCCCTACAAGTGTCCCAACTGC
TACCGGGCCTATTCGGACTCCGCTTCTTTGCAGATCCACCTCTCGGCCCACGCCA
TCAAGCACGCCAAGGCCTACTGCTGCAGCATGTGTGGGCGGGCCTACACCTCGGA
GACCTACCTGATGAAGCACATGTCCAAACACACGGTGGTGGAGCACCTGGTGAGC
CATCACTCGCCCCAGAGGACGGAGTCCCCCGGCATCCCGGTGCGAATCTCTCTCA
TCTGAGCCCACTGGAGGCGCCGCCCCACCCGGCCCACTGGCAGACACAGACCCAG
GCAGCACCAGGCCCCAGCTCCCTCCGGGGGCCCTCCAGGAACCACCAAGCTCTCT
CACGACCTTCCCAATCTTC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.