Search our product database

Search options:
Product name: hNUP37 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04801-1
Sigma Product ID: EHU048011
Species: Homo sapiens
Ensembl Gene ID: ENSG00000075188
Ensembl Transcript ID: ENST00000251074, ENST00000543021, ENST00000551200, ENST00000551744, ENST00000552283
Gene coordinates (GRCh38): 12:102073103-102120124
HGNC Alias: FLJ22618, MGC5585
HGNC ID: HGNC:29929
HGNC Symbol: NUP37
NCBI gene: 79023
RefSeq mRNA: NM_024057
Sequence:TTTGAGAATGGGGATTCAGGAAACCTAATTGCATATGGTGGCAATAATTATGTGG
TCATTGGCACGTGTACGTTTCAGGAAGAAGAAGCAGACGTTGAAGGCATTCAGTA
TAAAACACTTCGAACATTTCACCATGGAGTCAGGGTTGATGGCATAGCTTGGAGC
CCAGAGACTAGACTTGATTCATTGCCTCCAGTAATCAAATTTTGTACTTCAGCTG
CTGATATGAAAATTAGATTATTTACTTCAGATCTTCAGGATAAAAATGAATATAA
GGTTTTAGAGGGCCATACCGATTTCATTAATGGTTTGGTGTTTGATCCCAAAGAA
GGCCAAGAAATTGCAAGTGTGAGTGACGATCACACCTGCAGGATTTGGAACTTGG
AAGGAGTGCAAACAGCTC
Product name: hNUP37 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04801-1
Sigma Product ID: EHU048011
Species: Homo sapiens
Ensembl Gene ID: ENSG00000075188
Ensembl Transcript ID: ENST00000251074, ENST00000543021, ENST00000551200, ENST00000551744, ENST00000552283
Gene coordinates (GRCh38): 12:102073103-102120124
HGNC Alias: FLJ22618, MGC5585
HGNC ID: HGNC:29929
HGNC Symbol: NUP37
NCBI gene: 79023
RefSeq mRNA: NM_024057
Sequence:TTTGAGAATGGGGATTCAGGAAACCTAATTGCATATGGTGGCAATAATTATGTGG
TCATTGGCACGTGTACGTTTCAGGAAGAAGAAGCAGACGTTGAAGGCATTCAGTA
TAAAACACTTCGAACATTTCACCATGGAGTCAGGGTTGATGGCATAGCTTGGAGC
CCAGAGACTAGACTTGATTCATTGCCTCCAGTAATCAAATTTTGTACTTCAGCTG
CTGATATGAAAATTAGATTATTTACTTCAGATCTTCAGGATAAAAATGAATATAA
GGTTTTAGAGGGCCATACCGATTTCATTAATGGTTTGGTGTTTGATCCCAAAGAA
GGCCAAGAAATTGCAAGTGTGAGTGACGATCACACCTGCAGGATTTGGAACTTGG
AAGGAGTGCAAACAGCTC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.