Search our product database

Search options:
Product name: hPDK3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04813-1
Sigma Product ID: EHU048131
Species: Homo sapiens
Ensembl Gene ID: ENSG00000067992
Ensembl Transcript ID: ENST00000379162, ENST00000441463, ENST00000648777
Gene coordinates (GRCh38): X:24465221-24541862
HGNC ID: HGNC:8811
HGNC Symbol: PDK3
NCBI gene: 5165
RefSeq mRNA: NM_001142386, NM_005391
Sequence:CCTTCAGTGGGATTGGTTCAGAGTTGGTATATGCAGAGTTTTCTTGAACTTTTAG
AATATGAAAATAAGAGCCCTGAGGATCCACAGGTCTTGGATAACTTTCTACAAGT
TCTGATTAAAGTCAGAAATAGACACAATGATGTGGTTCCTACAATGGCACAAGGA
GTGATTGAATACAAGGAGAAGTTTGGGTTTGATCCTTTCATTAGCACTAACATCC
AATATTTTCTGGATCGGTTTTATACCAACCGCATCTCTTTCCGCATGCTTATTAA
TCAGCACACACTTCTGTTTGGGGGTGACACTAATCCTGTTCATCCTAAACACATA
GGAAGTATCGATCCCACCTGTAACGTGGCGGATGTGGTGAAAGATGCATATGAAA
CAGCCAAGATGCTGTGTG
Product name: hPDK3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04813-1
Sigma Product ID: EHU048131
Species: Homo sapiens
Ensembl Gene ID: ENSG00000067992
Ensembl Transcript ID: ENST00000379162, ENST00000441463, ENST00000648777
Gene coordinates (GRCh38): X:24465221-24541862
HGNC ID: HGNC:8811
HGNC Symbol: PDK3
NCBI gene: 5165
RefSeq mRNA: NM_001142386, NM_005391
Sequence:CCTTCAGTGGGATTGGTTCAGAGTTGGTATATGCAGAGTTTTCTTGAACTTTTAG
AATATGAAAATAAGAGCCCTGAGGATCCACAGGTCTTGGATAACTTTCTACAAGT
TCTGATTAAAGTCAGAAATAGACACAATGATGTGGTTCCTACAATGGCACAAGGA
GTGATTGAATACAAGGAGAAGTTTGGGTTTGATCCTTTCATTAGCACTAACATCC
AATATTTTCTGGATCGGTTTTATACCAACCGCATCTCTTTCCGCATGCTTATTAA
TCAGCACACACTTCTGTTTGGGGGTGACACTAATCCTGTTCATCCTAAACACATA
GGAAGTATCGATCCCACCTGTAACGTGGCGGATGTGGTGAAAGATGCATATGAAA
CAGCCAAGATGCTGTGTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.