Search our product database

Search options:
Product name: hSEH1L €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04916-1
Sigma Product ID: EHU049161
Species: Homo sapiens
Ensembl Gene ID: ENSG00000085415
Ensembl Transcript ID: ENST00000262124, ENST00000590843, ENST00000592582
Gene coordinates (GRCh38): 18:12947133-12987536
HGNC Alias: SEC13L, Seh1, SEH1A, SEH1B
HGNC ID: HGNC:30379
HGNC Symbol: SEH1L
NCBI gene: 81929
RefSeq mRNA: NM_031216
Sequence:TGATATTGCATTCGCTCCAAATTTGGGAAGATCTTTCCATATTCTAGCAATAGCG
ACCAAAGATGTGAGAATTTTTACATTAAAGCCTGTGAGGAAAGAACTGACTTCCT
CTGGTGGGCCAACAAAGTTTGAAATCCATATAGTGGCTCAGTTCGATAATCATAA
TTCTCAGGTCTGGCGAGTGAGTTGGAATATAACAGGAACGGTGCTAGCATCTTCA
GGAGATGATGGGTGTGTAAGATTGTGGAAAGCTAATTATATGGACAATTGGAAGT
GTACTGGTATTTTGAAAGGTAATGGGAGCCCAGTCAATGGGAGTTCTCAGCAGGG
AACCTCAAATCCTTCCCTAGGTTCAACTATTCCAAGTCTTCAGAATTCATTAAAT
GGATCTTCTGCTGGCAGAAAGCACAGCTGAGTACAAGCTAACTGGAGTAACTTTG
CTGTTTTGCTGCTTG
Product name: hSEH1L €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04916-1
Sigma Product ID: EHU049161
Species: Homo sapiens
Ensembl Gene ID: ENSG00000085415
Ensembl Transcript ID: ENST00000262124, ENST00000590843, ENST00000592582
Gene coordinates (GRCh38): 18:12947133-12987536
HGNC Alias: SEC13L, Seh1, SEH1A, SEH1B
HGNC ID: HGNC:30379
HGNC Symbol: SEH1L
NCBI gene: 81929
RefSeq mRNA: NM_031216
Sequence:TGATATTGCATTCGCTCCAAATTTGGGAAGATCTTTCCATATTCTAGCAATAGCG
ACCAAAGATGTGAGAATTTTTACATTAAAGCCTGTGAGGAAAGAACTGACTTCCT
CTGGTGGGCCAACAAAGTTTGAAATCCATATAGTGGCTCAGTTCGATAATCATAA
TTCTCAGGTCTGGCGAGTGAGTTGGAATATAACAGGAACGGTGCTAGCATCTTCA
GGAGATGATGGGTGTGTAAGATTGTGGAAAGCTAATTATATGGACAATTGGAAGT
GTACTGGTATTTTGAAAGGTAATGGGAGCCCAGTCAATGGGAGTTCTCAGCAGGG
AACCTCAAATCCTTCCCTAGGTTCAACTATTCCAAGTCTTCAGAATTCATTAAAT
GGATCTTCTGCTGGCAGAAAGCACAGCTGAGTACAAGCTAACTGGAGTAACTTTG
CTGTTTTGCTGCTTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.