Search our product database

Search options:
Product name: hZCCHC24 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04986-1
Sigma Product ID: EHU049861
Species: Homo sapiens
Ensembl Gene ID: ENSG00000165424
Ensembl Transcript ID: ENST00000372336
Gene coordinates (GRCh38): 10:79382325-79445627
HGNC Alias: C10orf56, FLJ90798, Z3CXXC8
HGNC ID: HGNC:26911
HGNC Symbol: ZCCHC24
NCBI gene: 219654
RefSeq mRNA: NM_153367
Sequence:CCCTGCACTCCAGCTATCTCAACAGCTTCTTCCAGCTGCAGCGCGGAGAGGCGCT
GAGCAACAGTGTGTACAAGGGCGCCTCACCCTATGGCTCCCTCAACAACATCGCC
GATGGCCTCAGCTCCCTCACCGAGCACTTCTCAGACCTGACCCTCACCTCCGAGG
CTCGCAAGCCCAGCAAGCGGCCCCCACCCAACTACCTGTGCCACCTGTGCTTCAA
CAAAGGACACTACATCAAGGACTGCCCCCAGGCACGCCCCAAAGGCGAGGGCCTG
ACTCCATACCAGGGCAAAAAGCGCTGCTTCGGCGAGTACAAGTGTCCCAAGTGCA
AGAGAAAATGGATGAGCGGGAACTCCTGGGCCAACATGGGGCAGGAGTGCATCAA
GTGCCACATCAACGTGT
Product name: hZCCHC24 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-04986-1
Sigma Product ID: EHU049861
Species: Homo sapiens
Ensembl Gene ID: ENSG00000165424
Ensembl Transcript ID: ENST00000372336
Gene coordinates (GRCh38): 10:79382325-79445627
HGNC Alias: C10orf56, FLJ90798, Z3CXXC8
HGNC ID: HGNC:26911
HGNC Symbol: ZCCHC24
NCBI gene: 219654
RefSeq mRNA: NM_153367
Sequence:CCCTGCACTCCAGCTATCTCAACAGCTTCTTCCAGCTGCAGCGCGGAGAGGCGCT
GAGCAACAGTGTGTACAAGGGCGCCTCACCCTATGGCTCCCTCAACAACATCGCC
GATGGCCTCAGCTCCCTCACCGAGCACTTCTCAGACCTGACCCTCACCTCCGAGG
CTCGCAAGCCCAGCAAGCGGCCCCCACCCAACTACCTGTGCCACCTGTGCTTCAA
CAAAGGACACTACATCAAGGACTGCCCCCAGGCACGCCCCAAAGGCGAGGGCCTG
ACTCCATACCAGGGCAAAAAGCGCTGCTTCGGCGAGTACAAGTGTCCCAAGTGCA
AGAGAAAATGGATGAGCGGGAACTCCTGGGCCAACATGGGGCAGGAGTGCATCAA
GTGCCACATCAACGTGT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.