Search our product database

Search options:
Product name: hPPP1R35 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05153-1
Sigma Product ID: EHU051531
Species: Homo sapiens
Ensembl Gene ID: ENSG00000160813
Ensembl Transcript ID: ENST00000292330, ENST00000470295, ENST00000487452
Gene coordinates (GRCh38): 7:100435282-100436565
HGNC Alias: C7orf47, MGC22793
HGNC ID: HGNC:28320
HGNC Symbol: PPP1R35
NCBI gene: 221908
RefSeq mRNA: NM_001346938, NM_145030
Sequence:CGTGGAGGAACAGCTGAGAAAGTCGTTCCAGATCCGCTGCGGCCTGGAGGAGAGC
GTGTCCGAGGGGCTGAACGTGCCGCGCTCCAAGCGGCTCTTCCGGGACCTGGTGA
GCCTGCAGGTGCCGGAGGAACAGGTTCTGAATGCCGCGCTCAGGGAGAAATTGGC
TCTCCTGCCGCCACAGGCTCGAGCCCCGCACCCAAAGGAGCCACCTGGGCCTGGG
CCAGACATGACCATCTTGTGTGACCCAGAAACGCTATTTTATGAATCTCCACACC
TGACCCTGGACGGTCTGCCCCCTCTCCGACTTCAACTCCGGCCCCGCCCTTCAGA
GGACACCTTCCTCATGCACCGGACACTGAGGCGATGGGAAGCGTAGACCCCAAAG
ATCCCTGGAGGGCTAG
Product name: hPPP1R35 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05153-1
Sigma Product ID: EHU051531
Species: Homo sapiens
Ensembl Gene ID: ENSG00000160813
Ensembl Transcript ID: ENST00000292330, ENST00000470295, ENST00000487452
Gene coordinates (GRCh38): 7:100435282-100436565
HGNC Alias: C7orf47, MGC22793
HGNC ID: HGNC:28320
HGNC Symbol: PPP1R35
NCBI gene: 221908
RefSeq mRNA: NM_001346938, NM_145030
Sequence:CGTGGAGGAACAGCTGAGAAAGTCGTTCCAGATCCGCTGCGGCCTGGAGGAGAGC
GTGTCCGAGGGGCTGAACGTGCCGCGCTCCAAGCGGCTCTTCCGGGACCTGGTGA
GCCTGCAGGTGCCGGAGGAACAGGTTCTGAATGCCGCGCTCAGGGAGAAATTGGC
TCTCCTGCCGCCACAGGCTCGAGCCCCGCACCCAAAGGAGCCACCTGGGCCTGGG
CCAGACATGACCATCTTGTGTGACCCAGAAACGCTATTTTATGAATCTCCACACC
TGACCCTGGACGGTCTGCCCCCTCTCCGACTTCAACTCCGGCCCCGCCCTTCAGA
GGACACCTTCCTCATGCACCGGACACTGAGGCGATGGGAAGCGTAGACCCCAAAG
ATCCCTGGAGGGCTAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.