Search our product database

Search options:
Product name: hGPR88 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05190-1
Sigma Product ID: EHU051901
Species: Homo sapiens
Ensembl Gene ID: ENSG00000181656
Ensembl Transcript ID: ENST00000315033
Gene coordinates (GRCh38): 1:100538137-100542018
HGNC ID: HGNC:4539
HGNC Symbol: GPR88
NCBI gene: 54112
RefSeq mRNA: NM_022049
Sequence:ACAGGGTGCTCTCCTCTTGAGCTCAGCTTCTGCTTTTGCAGCCAAGCATTCTTGC
TGCTGCTGCCTGCCTGCCCACCCGCCTGGGCTTGCAGCCCGCCACTTTACTTTCT
CCAGCCCTGATACCAGCTGAGAAGTCTCCCTGCAGCTGCTAGTTCCTGCCCAGGA
CCATGTGTGTGGATGCTGCTTGGGAGAAGCGGGCACTTGCTCCTGGCACTGATCC
CAGCTGAGTTTCTCCTGTTGATTTCTGGACCACTGATGCTGTTGCTGAGGAGGTA
TTTCCCGGCATCCCTCCCCCTGAGACACCGGCTAAGGACCAGCCTAAACGCAAGG
CAGGACAGTGTCAGGATGGACCGCGCTGCCAGAAGCCGACGCTAGCGAGGGAGGT
GTGAAGAGTTGGCCAG
Product name: hGPR88 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05190-1
Sigma Product ID: EHU051901
Species: Homo sapiens
Ensembl Gene ID: ENSG00000181656
Ensembl Transcript ID: ENST00000315033
Gene coordinates (GRCh38): 1:100538137-100542018
HGNC ID: HGNC:4539
HGNC Symbol: GPR88
NCBI gene: 54112
RefSeq mRNA: NM_022049
Sequence:ACAGGGTGCTCTCCTCTTGAGCTCAGCTTCTGCTTTTGCAGCCAAGCATTCTTGC
TGCTGCTGCCTGCCTGCCCACCCGCCTGGGCTTGCAGCCCGCCACTTTACTTTCT
CCAGCCCTGATACCAGCTGAGAAGTCTCCCTGCAGCTGCTAGTTCCTGCCCAGGA
CCATGTGTGTGGATGCTGCTTGGGAGAAGCGGGCACTTGCTCCTGGCACTGATCC
CAGCTGAGTTTCTCCTGTTGATTTCTGGACCACTGATGCTGTTGCTGAGGAGGTA
TTTCCCGGCATCCCTCCCCCTGAGACACCGGCTAAGGACCAGCCTAAACGCAAGG
CAGGACAGTGTCAGGATGGACCGCGCTGCCAGAAGCCGACGCTAGCGAGGGAGGT
GTGAAGAGTTGGCCAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.