Search our product database

Search options:
Product name: hRPA1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05411-1
Sigma Product ID: EHU054111
Species: Homo sapiens
Ensembl Gene ID: ENSG00000132383
Ensembl Transcript ID: ENST00000254719
Gene coordinates (GRCh38): 17:1829702-1900082
HGNC Alias: HSSB, REPA1, RF-A, RP-A, RPA70
HGNC ID: HGNC:10289
HGNC Symbol: RPA1
NCBI gene: 6117
RefSeq mRNA: NM_001355120, NM_001355121, NM_002945
Sequence:TGGTTGACGAAAGTGGTGAAATCCGAGCTACAGCTTTCAATGAGCAAGTGGACAA
GTTCTTTCCTCTTATTGAAGTGAACAAGGTGTATTATTTCTCGAAAGGCACCCTG
AAGATTGCTAACAAGCAGTTCACAGCTGTTAAAAATGACTACGAGATGACCTTCA
ATAACGAGACTTCCGTCATGCCCTGTGAGGACGACCATCATTTACCTACGGTTCA
GTTTGATTTCACGGGGATTGATGACCTCGAGAACAAGTCGAAAGACTCACTTGTA
GACATCATCGGGATCTGCAAGAGCTATGAAGACGCCACTAAAATCACAGTGAGGT
CTAACAACAGAGAAGTTGCCAAGAGGAATATCTACTTGATGGACACATCCGGGAA
GGTGGTGACTGCTACACTGTGGGGGGAAGATGCTGATAAATTTGATGGTTCTAGA
CAGCCCGTG
Product name: hRPA1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05411-1
Sigma Product ID: EHU054111
Species: Homo sapiens
Ensembl Gene ID: ENSG00000132383
Ensembl Transcript ID: ENST00000254719
Gene coordinates (GRCh38): 17:1829702-1900082
HGNC Alias: HSSB, REPA1, RF-A, RP-A, RPA70
HGNC ID: HGNC:10289
HGNC Symbol: RPA1
NCBI gene: 6117
RefSeq mRNA: NM_001355120, NM_001355121, NM_002945
Sequence:TGGTTGACGAAAGTGGTGAAATCCGAGCTACAGCTTTCAATGAGCAAGTGGACAA
GTTCTTTCCTCTTATTGAAGTGAACAAGGTGTATTATTTCTCGAAAGGCACCCTG
AAGATTGCTAACAAGCAGTTCACAGCTGTTAAAAATGACTACGAGATGACCTTCA
ATAACGAGACTTCCGTCATGCCCTGTGAGGACGACCATCATTTACCTACGGTTCA
GTTTGATTTCACGGGGATTGATGACCTCGAGAACAAGTCGAAAGACTCACTTGTA
GACATCATCGGGATCTGCAAGAGCTATGAAGACGCCACTAAAATCACAGTGAGGT
CTAACAACAGAGAAGTTGCCAAGAGGAATATCTACTTGATGGACACATCCGGGAA
GGTGGTGACTGCTACACTGTGGGGGGAAGATGCTGATAAATTTGATGGTTCTAGA
CAGCCCGTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.