Search our product database

Search options:
Product name: hEIF2S1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05444-1
Sigma Product ID: EHU054441
Species: Homo sapiens
Ensembl Gene ID: ENSG00000134001
Ensembl Transcript ID: ENST00000256383, ENST00000466499, ENST00000557310
Gene coordinates (GRCh38): 14:67359997-67386516
HGNC Alias: EIF2, EIF2A, EIF-2alpha
HGNC ID: HGNC:3265
HGNC Symbol: EIF2S1
NCBI gene: 1965
RefSeq mRNA: NM_004094
Sequence:CACAAATTTCCTGAGGTGGAAGATGTAGTGATGGTGAATGTCAGATCCATTGCTG
AAATGGGGGCTTATGTCAGCTTGCTGGAATACAACAACATTGAAGGCATGATTCT
TCTTAGTGAATTATCCAGAAGGCGTATCCGTTCTATCAACAAACTCATCCGAATT
GGCAGGAATGAGTGTGTGGTTGTCATTAGGGTGGACAAAGAAAAAGGATATATTG
ATTTGTCAAAAAGAAGAGTTTCTCCAGAGGAAGCAATCAAATGTGAAGACAAATT
CACAAAATCCAAAACTGTTTATAGCATTCTTCGTCATGTTGCTGAGGTGTTAGAA
TACACCAAGGATGAGCAGCTGGAAAGCCTATTCCAGAGGACTGCCTGGGTCTTTG
ATGACAAGTACAAGAGACCTGGATATGGTGCCTATGATGCATTTAAGCATGCAGT
CTCAGACCC
Product name: hEIF2S1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05444-1
Sigma Product ID: EHU054441
Species: Homo sapiens
Ensembl Gene ID: ENSG00000134001
Ensembl Transcript ID: ENST00000256383, ENST00000466499, ENST00000557310
Gene coordinates (GRCh38): 14:67359997-67386516
HGNC Alias: EIF2, EIF2A, EIF-2alpha
HGNC ID: HGNC:3265
HGNC Symbol: EIF2S1
NCBI gene: 1965
RefSeq mRNA: NM_004094
Sequence:CACAAATTTCCTGAGGTGGAAGATGTAGTGATGGTGAATGTCAGATCCATTGCTG
AAATGGGGGCTTATGTCAGCTTGCTGGAATACAACAACATTGAAGGCATGATTCT
TCTTAGTGAATTATCCAGAAGGCGTATCCGTTCTATCAACAAACTCATCCGAATT
GGCAGGAATGAGTGTGTGGTTGTCATTAGGGTGGACAAAGAAAAAGGATATATTG
ATTTGTCAAAAAGAAGAGTTTCTCCAGAGGAAGCAATCAAATGTGAAGACAAATT
CACAAAATCCAAAACTGTTTATAGCATTCTTCGTCATGTTGCTGAGGTGTTAGAA
TACACCAAGGATGAGCAGCTGGAAAGCCTATTCCAGAGGACTGCCTGGGTCTTTG
ATGACAAGTACAAGAGACCTGGATATGGTGCCTATGATGCATTTAAGCATGCAGT
CTCAGACCC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.