Search our product database

Search options:
Product name: hTUBG1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05641-1
Sigma Product ID: EHU056411
Species: Homo sapiens
Ensembl Gene ID: ENSG00000131462
Ensembl Transcript ID: ENST00000251413, ENST00000591509
Gene coordinates (GRCh38): 17:42609676-42615234
HGNC Alias: TUBG, TUBGCP1
HGNC ID: HGNC:12417
HGNC Symbol: TUBG1
NCBI gene: 7283
RefSeq mRNA: NM_001070
Sequence:CCCCTATGCCAAGCTCTACAACCCAGAGAACATCTACCTGTCGGAACATGGAGGA
GGAGCTGGCAACAACTGGGCCAGCGGATTCTCCCAGGGAGAAAAGATCCATGAGG
ACATTTTTGACATCATAGACCGGGAGGCAGATGGTAGTGACAGTCTAGAGGGCTT
TGTGCTGTGTCACTCCATTGCTGGGGGGACAGGCTCTGGACTGGGTTCCTACCTC
TTAGAACGGCTGAATGACAGGTATCCTAAGAAGCTGGTGCAGACATACTCAGTGT
TTCCCAACCAGGACGAGATGAGCGATGTGGTGGTCCAGCCTTACAATTCACTCCT
CACACTCAAGAGGCTGACGCAGAATGCAGACTGTGTGGTGGTGCTGGACAACACA
GCCCTGAACCGGATTGCCACAGACCGCCTGCACATCCAGAACCCATCCTTCTCCC
AGATCAA
Product name: hTUBG1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05641-1
Sigma Product ID: EHU056411
Species: Homo sapiens
Ensembl Gene ID: ENSG00000131462
Ensembl Transcript ID: ENST00000251413, ENST00000591509
Gene coordinates (GRCh38): 17:42609676-42615234
HGNC Alias: TUBG, TUBGCP1
HGNC ID: HGNC:12417
HGNC Symbol: TUBG1
NCBI gene: 7283
RefSeq mRNA: NM_001070
Sequence:CCCCTATGCCAAGCTCTACAACCCAGAGAACATCTACCTGTCGGAACATGGAGGA
GGAGCTGGCAACAACTGGGCCAGCGGATTCTCCCAGGGAGAAAAGATCCATGAGG
ACATTTTTGACATCATAGACCGGGAGGCAGATGGTAGTGACAGTCTAGAGGGCTT
TGTGCTGTGTCACTCCATTGCTGGGGGGACAGGCTCTGGACTGGGTTCCTACCTC
TTAGAACGGCTGAATGACAGGTATCCTAAGAAGCTGGTGCAGACATACTCAGTGT
TTCCCAACCAGGACGAGATGAGCGATGTGGTGGTCCAGCCTTACAATTCACTCCT
CACACTCAAGAGGCTGACGCAGAATGCAGACTGTGTGGTGGTGCTGGACAACACA
GCCCTGAACCGGATTGCCACAGACCGCCTGCACATCCAGAACCCATCCTTCTCCC
AGATCAA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.