Search our product database

Search options:
Product name: hCLU €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05800-1
Sigma Product ID: EHU058001
Species: Homo sapiens
Ensembl Gene ID: ENSG00000120885
Ensembl Transcript ID: ENST00000316403, ENST00000405140, ENST00000519742, ENST00000520796, ENST00000522299, ENST00000523500, ENST00000523589, ENST00000560566
Gene coordinates (GRCh38): 8:27596917-27615031
HGNC Alias: APOJ, CLI, CLU1, CLU2, KUB1, SGP-2, SP-40, TRPM-2
HGNC ID: HGNC:2095
HGNC Symbol: CLU
NCBI gene: 1191
RefSeq mRNA: NM_001831
RefSeq ncRNA: NR_038335, NR_045494
Sequence:GACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTG
GGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTA
AGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGAC
TCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAA
GCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGC
TGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTG
TAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGT
GGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCT
TCTAC
Product name: hCLU €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05800-1
Sigma Product ID: EHU058001
Species: Homo sapiens
Ensembl Gene ID: ENSG00000120885
Ensembl Transcript ID: ENST00000316403, ENST00000405140, ENST00000519742, ENST00000520796, ENST00000522299, ENST00000523500, ENST00000523589, ENST00000560566
Gene coordinates (GRCh38): 8:27596917-27615031
HGNC Alias: APOJ, CLI, CLU1, CLU2, KUB1, SGP-2, SP-40, TRPM-2
HGNC ID: HGNC:2095
HGNC Symbol: CLU
NCBI gene: 1191
RefSeq mRNA: NM_001831
RefSeq ncRNA: NR_038335, NR_045494
Sequence:GACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTG
GGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTA
AGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGAC
TCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAA
GCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGC
TGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTG
TAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGT
GGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCT
TCTAC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.