Search our product database

Search options:
Product name: hNUMA1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05914-1
Sigma Product ID: EHU059141
Species: Homo sapiens
Ensembl Gene ID: ENSG00000137497
Ensembl Transcript ID: ENST00000351960, ENST00000358965, ENST00000393695, ENST00000541584, ENST00000545721, ENST00000613205, ENST00000616538, ENST00000620566
Gene coordinates (GRCh38): 11:72002864-72080693
HGNC ID: HGNC:8059
HGNC Symbol: NUMA1
NCBI gene: 4926
RefSeq mRNA: NM_001286561, NM_006185
RefSeq ncRNA: NR_104476
Sequence:AATTCCAGGTGGCAACTGATGCTTTAAAGAGCCGTGAGCCCCAGGCTAAGCCCCA
GCTGGACTTGAGTATTGACAGCCTGGATCTGAGCTGCGAGGAGGGGACCCCACTC
AGTATCACCAGCAAGCTGCCTCGTACCCAGCCAGACGGCACCAGCGTCCCTGGAG
AACCAGCCTCACCTATCTCCCAGCGCCTGCCCCCCAAGGTAGAATCCCTGGAGAG
TCTCTACTTCACTCCCATCCCTGCTCGGAGTCAGGCCCCCCTGGAGAGCAGCCTG
GACTCCCTGGGAGACGTCTTCCTGGACTCGGGTCGTAAGACCCGCTCCGCTCGTC
GGCGCACCACGCAGATCATCAACATCACCATGACCAAGAAGCTAGATGTGGAAGA
GCCAGACAGCGCCAACTCATCGTTCTACAGCACGC
Product name: hNUMA1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-05914-1
Sigma Product ID: EHU059141
Species: Homo sapiens
Ensembl Gene ID: ENSG00000137497
Ensembl Transcript ID: ENST00000351960, ENST00000358965, ENST00000393695, ENST00000541584, ENST00000545721, ENST00000613205, ENST00000616538, ENST00000620566
Gene coordinates (GRCh38): 11:72002864-72080693
HGNC ID: HGNC:8059
HGNC Symbol: NUMA1
NCBI gene: 4926
RefSeq mRNA: NM_001286561, NM_006185
RefSeq ncRNA: NR_104476
Sequence:AATTCCAGGTGGCAACTGATGCTTTAAAGAGCCGTGAGCCCCAGGCTAAGCCCCA
GCTGGACTTGAGTATTGACAGCCTGGATCTGAGCTGCGAGGAGGGGACCCCACTC
AGTATCACCAGCAAGCTGCCTCGTACCCAGCCAGACGGCACCAGCGTCCCTGGAG
AACCAGCCTCACCTATCTCCCAGCGCCTGCCCCCCAAGGTAGAATCCCTGGAGAG
TCTCTACTTCACTCCCATCCCTGCTCGGAGTCAGGCCCCCCTGGAGAGCAGCCTG
GACTCCCTGGGAGACGTCTTCCTGGACTCGGGTCGTAAGACCCGCTCCGCTCGTC
GGCGCACCACGCAGATCATCAACATCACCATGACCAAGAAGCTAGATGTGGAAGA
GCCAGACAGCGCCAACTCATCGTTCTACAGCACGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.