Search our product database

Search options:
Product name: hBECN1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06174-1
Sigma Product ID: EHU061741
Species: Homo sapiens
Ensembl Gene ID: ENSG00000126581
Ensembl Transcript ID: ENST00000361523, ENST00000543382, ENST00000590099, ENST00000617806
Gene coordinates (GRCh38): 17:42810134-42833350
HGNC Alias: ATG6, VPS30
HGNC ID: HGNC:1034
HGNC Symbol: BECN1
NCBI gene: 8678
RefSeq mRNA: NM_001313998, NM_001313999, NM_003766
Sequence:GGCTGAGAGACTGGATCAGGAGGAAGCTCAGTATCAGAGAGAATACAGTGAATTT
AAACGACAGCAGCTGGAGCTGGATGATGAGCTGAAGAGTGTTGAAAACCAGATGC
GTTATGCCCAGACGCAGCTGGATAAGCTGAAGAAAACCAACGTCTTTAATGCAAC
CTTCCACATCTGGCACAGTGGACAGTTTGGCACAATCAATAACTTCAGGCTGGGT
CGCCTGCCCAGTGTTCCCGTGGAATGGAATGAGATTAATGCTGCTTGGGGCCAGA
CTGTGTTGCTGCTCCATGCTCTGGCCAATAAGATGGGTCTGAAATTTCAGAGATA
CCGACTTGTTCCTTACGGAAACCATTCATATCTGGAGTCTCTGACAGACAAATCT
AAGGAGCTGCCGTTATACTGTTCTGGGGGGTTGCGGTTTTTCTGGGACAACAAGT
TTGACCATGCAATGGTGGCTTTCCTGGACTGTGTGCAG
Product name: hBECN1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06174-1
Sigma Product ID: EHU061741
Species: Homo sapiens
Ensembl Gene ID: ENSG00000126581
Ensembl Transcript ID: ENST00000361523, ENST00000543382, ENST00000590099, ENST00000617806
Gene coordinates (GRCh38): 17:42810134-42833350
HGNC Alias: ATG6, VPS30
HGNC ID: HGNC:1034
HGNC Symbol: BECN1
NCBI gene: 8678
RefSeq mRNA: NM_001313998, NM_001313999, NM_003766
Sequence:GGCTGAGAGACTGGATCAGGAGGAAGCTCAGTATCAGAGAGAATACAGTGAATTT
AAACGACAGCAGCTGGAGCTGGATGATGAGCTGAAGAGTGTTGAAAACCAGATGC
GTTATGCCCAGACGCAGCTGGATAAGCTGAAGAAAACCAACGTCTTTAATGCAAC
CTTCCACATCTGGCACAGTGGACAGTTTGGCACAATCAATAACTTCAGGCTGGGT
CGCCTGCCCAGTGTTCCCGTGGAATGGAATGAGATTAATGCTGCTTGGGGCCAGA
CTGTGTTGCTGCTCCATGCTCTGGCCAATAAGATGGGTCTGAAATTTCAGAGATA
CCGACTTGTTCCTTACGGAAACCATTCATATCTGGAGTCTCTGACAGACAAATCT
AAGGAGCTGCCGTTATACTGTTCTGGGGGGTTGCGGTTTTTCTGGGACAACAAGT
TTGACCATGCAATGGTGGCTTTCCTGGACTGTGTGCAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.