Search our product database

Search options:
Product name: hCDK2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06176-1
Sigma Product ID: EHU061761
Species: Homo sapiens
Ensembl Gene ID: ENSG00000123374
Ensembl Transcript ID: ENST00000266970, ENST00000354056, ENST00000553376, ENST00000555408
Gene coordinates (GRCh38): 12:55966769-55972784
HGNC ID: HGNC:1771
HGNC Symbol: CDK2
NCBI gene: 1017
RefSeq mRNA: NM_001798, NM_052827
Sequence:TGTACCTCCCCTGGATGAAGATGGACGGAGCTTGTTATCGCAAATGCTGCACTAC
GACCCTAACAAGCGGATTTCGGCCAAGGCAGCCCTGGCTCACCCTTTCTTCCAGG
ATGTGACCAAGCCAGTACCCCATCTTCGACTCTGATAGCCTTCTTGAAGCCCCCA
GCCCTAATCTCACCCTCTCCTCCAGTGTGGGCTTGACCAGGCTTGGCCTTGGGCT
ATTTGGACTCAGGTGGGCCCTCTGAACTTGCCTTAAACACTCACCTTCTAGTCTT
GGCCAGCCAACTCTGGGAATACAGGGGTGAAAGGGGGGAACCAGTGAAAATGAAA
GGAAGTTTCAGTATTAGATGCACTTAAGTTAGCCTCCACCACCCTTTCCCCCTTC
TCTTAGTTATTGCTGAAGAGGGTTGGTATAAAAATAATTTTAAAAAAGCCTTCCT
ACACGTTAGATTTGCCGTACCAATCTCTGAATGCCCC
Product name: hCDK2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06176-1
Sigma Product ID: EHU061761
Species: Homo sapiens
Ensembl Gene ID: ENSG00000123374
Ensembl Transcript ID: ENST00000266970, ENST00000354056, ENST00000553376, ENST00000555408
Gene coordinates (GRCh38): 12:55966769-55972784
HGNC ID: HGNC:1771
HGNC Symbol: CDK2
NCBI gene: 1017
RefSeq mRNA: NM_001798, NM_052827
Sequence:TGTACCTCCCCTGGATGAAGATGGACGGAGCTTGTTATCGCAAATGCTGCACTAC
GACCCTAACAAGCGGATTTCGGCCAAGGCAGCCCTGGCTCACCCTTTCTTCCAGG
ATGTGACCAAGCCAGTACCCCATCTTCGACTCTGATAGCCTTCTTGAAGCCCCCA
GCCCTAATCTCACCCTCTCCTCCAGTGTGGGCTTGACCAGGCTTGGCCTTGGGCT
ATTTGGACTCAGGTGGGCCCTCTGAACTTGCCTTAAACACTCACCTTCTAGTCTT
GGCCAGCCAACTCTGGGAATACAGGGGTGAAAGGGGGGAACCAGTGAAAATGAAA
GGAAGTTTCAGTATTAGATGCACTTAAGTTAGCCTCCACCACCCTTTCCCCCTTC
TCTTAGTTATTGCTGAAGAGGGTTGGTATAAAAATAATTTTAAAAAAGCCTTCCT
ACACGTTAGATTTGCCGTACCAATCTCTGAATGCCCC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.