Search our product database

Search options:
Product name: hCHD4 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06290-1
Sigma Product ID: EHU062901
Species: Homo sapiens
Ensembl Gene ID: ENSG00000111642, ENSG00000285238
Ensembl Transcript ID: ENST00000357008, ENST00000540960, ENST00000544040, ENST00000544484, ENST00000642594, ENST00000642810, ENST00000642879, ENST00000643335, ENST00000643538, ENST00000643815, ENST00000644137, ENST00000644289, ENST00000644352, ENST00000644356, ENST00000644480, ENST00000644801, ENST00000645005, ENST00000645022, ENST00000645095, ENST00000645645, ENST00000646366, ENST00000646608, ENST00000646806, ENST00000647483
Gene coordinates (GRCh38): 12:6556886-6607367, 12:6570082-6614524
HGNC Alias: Mi-2b, Mi2-BETA
HGNC ID: HGNC:1919
HGNC Symbol: CHD4
NCBI gene: 1108
RefSeq mRNA: NM_001273, NM_001297553, NM_001363606
Sequence:GATGCTGACGCATCTAGTGGTGCGGCCTGGGCTGGGCTCCAAGACTGGATCTATG
TCCAAACAGGAGCTTGATGATATCCTCAAATTTGGCACTGAGGAACTATTCAAGG
ATGAAGCCACTGATGGAGGAGGAGACAACAAAGAGGGAGAAGATAGCAGTGTTAT
CCACTACGATGATAAGGCCATTGAACGGCTGCTAGACCGTAACCAGGATGAGACT
GAAGACACAGAATTGCAGGGCATGAATGAATATTTGAGCTCATTCAAAGTGGCCC
AGTATGTGGTACGGGAAGAAGAAATGGGGGAGGAAGAGGAGGTAGAACGGGAAAT
CATTAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAATTGCTGCGGCAC
CATTATGAGCAGCAGCAAGAAGATCTAGCCCG
Product name: hCHD4 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06290-1
Sigma Product ID: EHU062901
Species: Homo sapiens
Ensembl Gene ID: ENSG00000111642, ENSG00000285238
Ensembl Transcript ID: ENST00000357008, ENST00000540960, ENST00000544040, ENST00000544484, ENST00000642594, ENST00000642810, ENST00000642879, ENST00000643335, ENST00000643538, ENST00000643815, ENST00000644137, ENST00000644289, ENST00000644352, ENST00000644356, ENST00000644480, ENST00000644801, ENST00000645005, ENST00000645022, ENST00000645095, ENST00000645645, ENST00000646366, ENST00000646608, ENST00000646806, ENST00000647483
Gene coordinates (GRCh38): 12:6556886-6607367, 12:6570082-6614524
HGNC Alias: Mi-2b, Mi2-BETA
HGNC ID: HGNC:1919
HGNC Symbol: CHD4
NCBI gene: 1108
RefSeq mRNA: NM_001273, NM_001297553, NM_001363606
Sequence:GATGCTGACGCATCTAGTGGTGCGGCCTGGGCTGGGCTCCAAGACTGGATCTATG
TCCAAACAGGAGCTTGATGATATCCTCAAATTTGGCACTGAGGAACTATTCAAGG
ATGAAGCCACTGATGGAGGAGGAGACAACAAAGAGGGAGAAGATAGCAGTGTTAT
CCACTACGATGATAAGGCCATTGAACGGCTGCTAGACCGTAACCAGGATGAGACT
GAAGACACAGAATTGCAGGGCATGAATGAATATTTGAGCTCATTCAAAGTGGCCC
AGTATGTGGTACGGGAAGAAGAAATGGGGGAGGAAGAGGAGGTAGAACGGGAAAT
CATTAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAATTGCTGCGGCAC
CATTATGAGCAGCAGCAAGAAGATCTAGCCCG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.