Search our product database

Search options:
Product name: hTACC3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06320-1
Sigma Product ID: EHU063201
Species: Homo sapiens
Ensembl Gene ID: ENSG00000013810
Ensembl Transcript ID: ENST00000313288, ENST00000612220, ENST00000617535
Gene coordinates (GRCh38): 4:1721490-1745176
HGNC Alias: ERIC1
HGNC ID: HGNC:11524
HGNC Symbol: TACC3
NCBI gene: 10460
RefSeq mRNA: NM_006342
Sequence:GAACTGGGGAAGATCATGGACAGGTTCGAAGAGGTTGTGTACCAGGCCATGGAGG
AAGTTCAGAAGCAGAAGGAACTTTCCAAAGCTGAAATCCAGAAAGTTCTAAAAGA
AAAAGACCAACTTACCACAGATCTGAACTCCATGGAGAAGTCCTTCTCCGACCTC
TTCAAGCGTTTTGAGAAACAGAAAGAGGTGATCGAGGGCTACCGCAAGAACGAAG
AGTCACTGAAGAAGTGCGTGGAGGATTACCTGGCAAGGATCACCCAGGAGGGCCA
GAGGTACCAAGCCCTGAAGGCCCACGCGGAGGAGAAGCTGCAGCTGGCAAACGAG
GAGATCGCCCAGGTCCGGAGCAAGGCCCAGGCGGAAGCGTTGGCCCTCCAGGCCA
GCCTGAGGAAGGAGCAGATGCGCATCCAGTCGCTGGAGAAGACAGTGGAGCAGAA
GACTAAAGAGAACGAGGAGCTGACCAGGATCTG
Product name: hTACC3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06320-1
Sigma Product ID: EHU063201
Species: Homo sapiens
Ensembl Gene ID: ENSG00000013810
Ensembl Transcript ID: ENST00000313288, ENST00000612220, ENST00000617535
Gene coordinates (GRCh38): 4:1721490-1745176
HGNC Alias: ERIC1
HGNC ID: HGNC:11524
HGNC Symbol: TACC3
NCBI gene: 10460
RefSeq mRNA: NM_006342
Sequence:GAACTGGGGAAGATCATGGACAGGTTCGAAGAGGTTGTGTACCAGGCCATGGAGG
AAGTTCAGAAGCAGAAGGAACTTTCCAAAGCTGAAATCCAGAAAGTTCTAAAAGA
AAAAGACCAACTTACCACAGATCTGAACTCCATGGAGAAGTCCTTCTCCGACCTC
TTCAAGCGTTTTGAGAAACAGAAAGAGGTGATCGAGGGCTACCGCAAGAACGAAG
AGTCACTGAAGAAGTGCGTGGAGGATTACCTGGCAAGGATCACCCAGGAGGGCCA
GAGGTACCAAGCCCTGAAGGCCCACGCGGAGGAGAAGCTGCAGCTGGCAAACGAG
GAGATCGCCCAGGTCCGGAGCAAGGCCCAGGCGGAAGCGTTGGCCCTCCAGGCCA
GCCTGAGGAAGGAGCAGATGCGCATCCAGTCGCTGGAGAAGACAGTGGAGCAGAA
GACTAAAGAGAACGAGGAGCTGACCAGGATCTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.