Search our product database

Search options:
Product name: hLMNA €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06379-1
Sigma Product ID: EHU063791
Species: Homo sapiens
Ensembl Gene ID: ENSG00000160789
Ensembl Transcript ID: ENST00000347559, ENST00000361308, ENST00000368297, ENST00000368299, ENST00000368300, ENST00000368301, ENST00000448611, ENST00000473598, ENST00000504687, ENST00000515459
Gene coordinates (GRCh38): 1:156082573-156140089
HGNC Alias: CMD1A, HGPS, LGMD1B, LMN1, LMNL1, MADA, PRO1
HGNC ID: HGNC:6636
HGNC Symbol: LMNA
NCBI gene: 4000
RefSeq mRNA: NM_001257374, NM_001282624, NM_001282625, NM_001282626, NM_005572, NM_170707, NM_170708
Sequence:ACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGG
CTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCAC
GCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCC
CTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTG
AGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAG
TGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGAC
AATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGC
GGGCCCAGCATGAGGACCAGGTGGAGCAGTA
Product name: hLMNA €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06379-1
Sigma Product ID: EHU063791
Species: Homo sapiens
Ensembl Gene ID: ENSG00000160789
Ensembl Transcript ID: ENST00000347559, ENST00000361308, ENST00000368297, ENST00000368299, ENST00000368300, ENST00000368301, ENST00000448611, ENST00000473598, ENST00000504687, ENST00000515459
Gene coordinates (GRCh38): 1:156082573-156140089
HGNC Alias: CMD1A, HGPS, LGMD1B, LMN1, LMNL1, MADA, PRO1
HGNC ID: HGNC:6636
HGNC Symbol: LMNA
NCBI gene: 4000
RefSeq mRNA: NM_001257374, NM_001282624, NM_001282625, NM_001282626, NM_005572, NM_170707, NM_170708
Sequence:ACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGG
CTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCAC
GCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCC
CTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTG
AGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAG
TGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGAC
AATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGC
GGGCCCAGCATGAGGACCAGGTGGAGCAGTA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.