Search our product database

Search options:
Product name: hCDK13 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06477-1
Sigma Product ID: EHU064771
Species: Homo sapiens
Ensembl Gene ID: ENSG00000065883
Ensembl Transcript ID: ENST00000181839, ENST00000340829, ENST00000484589, ENST00000611390, ENST00000613626, ENST00000643859, ENST00000643915, ENST00000645470, ENST00000646039
Gene coordinates (GRCh38): 7:39949646-40099580
HGNC Alias: CDC2L, CDC2L5, CHED, KIAA1791
HGNC ID: HGNC:1733
HGNC Symbol: CDK13
NCBI gene: 8621
RefSeq mRNA: NM_003718, NM_031267
Sequence:AAATTCTCCGGCAGCTTACCCATCAGAGTATTATCAATATGAAGGAAATAGTGAC
TGATAAAGAAGATGCTTTGGATTTCAAGAAGGACAAAGGTGCATTTTATCTGGTG
TTTGAATATATGGACCATGATCTGATGGGACTACTGGAATCAGGCTTGGTTCATT
TTAATGAAAATCACATAAAGTCATTTATGAGACAGCTCATGGAGGGTCTGGATTA
TTGTCATAAGAAGAACTTTTTGCATAGAGATATTAAATGTTCCAATATCCTTCTA
AATAATAGAGGGCAGATAAAACTTGCAGACTTTGGACTTGCTCGATTGTATAGCT
CAGAAGAAAGTCGGCCGTATACTAACAAGGTAATTACTTTATGGTACCGTCCACC
TGAACTGCTACTGGGAGAAGAACGATACACACCAGCCATTGATGTATGGAGCTGT
GGCTGTATCCTTGGCGAACTCTTCACT
Product name: hCDK13 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06477-1
Sigma Product ID: EHU064771
Species: Homo sapiens
Ensembl Gene ID: ENSG00000065883
Ensembl Transcript ID: ENST00000181839, ENST00000340829, ENST00000484589, ENST00000611390, ENST00000613626, ENST00000643859, ENST00000643915, ENST00000645470, ENST00000646039
Gene coordinates (GRCh38): 7:39949646-40099580
HGNC Alias: CDC2L, CDC2L5, CHED, KIAA1791
HGNC ID: HGNC:1733
HGNC Symbol: CDK13
NCBI gene: 8621
RefSeq mRNA: NM_003718, NM_031267
Sequence:AAATTCTCCGGCAGCTTACCCATCAGAGTATTATCAATATGAAGGAAATAGTGAC
TGATAAAGAAGATGCTTTGGATTTCAAGAAGGACAAAGGTGCATTTTATCTGGTG
TTTGAATATATGGACCATGATCTGATGGGACTACTGGAATCAGGCTTGGTTCATT
TTAATGAAAATCACATAAAGTCATTTATGAGACAGCTCATGGAGGGTCTGGATTA
TTGTCATAAGAAGAACTTTTTGCATAGAGATATTAAATGTTCCAATATCCTTCTA
AATAATAGAGGGCAGATAAAACTTGCAGACTTTGGACTTGCTCGATTGTATAGCT
CAGAAGAAAGTCGGCCGTATACTAACAAGGTAATTACTTTATGGTACCGTCCACC
TGAACTGCTACTGGGAGAAGAACGATACACACCAGCCATTGATGTATGGAGCTGT
GGCTGTATCCTTGGCGAACTCTTCACT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.