Search our product database

Search options:
Product name: hHNRNPK €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06567-1
Sigma Product ID: EHU065671
Species: Homo sapiens
Ensembl Gene ID: ENSG00000165119
Ensembl Transcript ID: ENST00000351839, ENST00000360384, ENST00000376263, ENST00000376281
Gene coordinates (GRCh38): 9:83968083-83980616
HGNC Alias: CSBP, HNRPK, TUNP
HGNC ID: HGNC:5044
HGNC Symbol: HNRNPK
NCBI gene: 3190
RefSeq mRNA: NM_001318186, NM_001318187, NM_001318188, NM_002140, NM_031262, NM_031263
Sequence:GACCCAGAACGCTTCAGTTCTGCTCTGCAAGGATATATAATAACTGATTGGTGTG
CCCGTTTAATAAAAGAATATGGAAACTGAACAGCCAGAAGAAACCTTCCCTAACA
CTGAAACCAATGGTGAATTTGGTAAACGCCCTGCAGAAGATATGGAAGAGGAACA
AGCATTTAAAAGATCTAGAAACACTGATGAGATGGTTGAATTACGCATTCTGCTT
CAGAGCAAGAATGCTGGGGCAGTGATTGGAAAAGGAGGCAAGAATATTAAGGCTC
TCCGTACAGACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCCCCGAGCG
CATATTGAGTATCAGTGCTGATATTGAAACAATTGGAGAAATTCTGAAGAAAATC
ATCCCTACCTTGGAAGAGGGCCTGCAGTTGCCATCACCCACTGCAACCAGCCAGC
TCCCGCTCGAATCTGATGCTGTGGA
Product name: hHNRNPK €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06567-1
Sigma Product ID: EHU065671
Species: Homo sapiens
Ensembl Gene ID: ENSG00000165119
Ensembl Transcript ID: ENST00000351839, ENST00000360384, ENST00000376263, ENST00000376281
Gene coordinates (GRCh38): 9:83968083-83980616
HGNC Alias: CSBP, HNRPK, TUNP
HGNC ID: HGNC:5044
HGNC Symbol: HNRNPK
NCBI gene: 3190
RefSeq mRNA: NM_001318186, NM_001318187, NM_001318188, NM_002140, NM_031262, NM_031263
Sequence:GACCCAGAACGCTTCAGTTCTGCTCTGCAAGGATATATAATAACTGATTGGTGTG
CCCGTTTAATAAAAGAATATGGAAACTGAACAGCCAGAAGAAACCTTCCCTAACA
CTGAAACCAATGGTGAATTTGGTAAACGCCCTGCAGAAGATATGGAAGAGGAACA
AGCATTTAAAAGATCTAGAAACACTGATGAGATGGTTGAATTACGCATTCTGCTT
CAGAGCAAGAATGCTGGGGCAGTGATTGGAAAAGGAGGCAAGAATATTAAGGCTC
TCCGTACAGACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCCCCGAGCG
CATATTGAGTATCAGTGCTGATATTGAAACAATTGGAGAAATTCTGAAGAAAATC
ATCCCTACCTTGGAAGAGGGCCTGCAGTTGCCATCACCCACTGCAACCAGCCAGC
TCCCGCTCGAATCTGATGCTGTGGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.