Search our product database

Search options:
Product name: hKIF23 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06612-1
Sigma Product ID: EHU066121
Species: Homo sapiens
Ensembl Gene ID: ENSG00000137807
Ensembl Transcript ID: ENST00000260363, ENST00000352331, ENST00000395392, ENST00000558346, ENST00000559279, ENST00000643966, ENST00000647715
Gene coordinates (GRCh38): 15:69414246-69448427
HGNC Alias: KNSL5, MKLP-1, MKLP1
HGNC ID: HGNC:6392
HGNC Symbol: KIF23
NCBI gene: 9493
RefSeq mRNA: NM_001281301, NM_004856, NM_138555
Sequence:TCCTCGTTGTTTGGACATGATCTTTAACAGTATAGGGTCATTTCAAGCTAAACGA
TATGTTTTCAAATCTAATGATAGGAATAGTATGGATATACAGTGTGAGGTTGATG
CCTTATTAGAACGTCAGAAAAGAGAAGCTATGCCCAATCCAAAGACTTCTTCTAG
CAAACGACAAGTAGATCCAGAGTTTGCAGATATGATAACTGTACAAGAATTCTGC
AAAGCAGAAGAGGTTGATGAAGATAGTGTCTATGGTGTATTTGTCTCTTATATTG
AAATATATAATAATTACATATATGATCTATTGGAAGAGGTGCCGTTTGATCCCAT
AAAACCCAAACCTCCACAATCTAAATTGCTTCGTGAAGATAAGAACCATAACATG
TATGTTGCAGGATGTACAGAAGTTGAAGTGAAATCTACTGAGGAGGCTTTTGAAG
TTTTCTGGAGAGGCCAGAAAAAGAG
Product name: hKIF23 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06612-1
Sigma Product ID: EHU066121
Species: Homo sapiens
Ensembl Gene ID: ENSG00000137807
Ensembl Transcript ID: ENST00000260363, ENST00000352331, ENST00000395392, ENST00000558346, ENST00000559279, ENST00000643966, ENST00000647715
Gene coordinates (GRCh38): 15:69414246-69448427
HGNC Alias: KNSL5, MKLP-1, MKLP1
HGNC ID: HGNC:6392
HGNC Symbol: KIF23
NCBI gene: 9493
RefSeq mRNA: NM_001281301, NM_004856, NM_138555
Sequence:TCCTCGTTGTTTGGACATGATCTTTAACAGTATAGGGTCATTTCAAGCTAAACGA
TATGTTTTCAAATCTAATGATAGGAATAGTATGGATATACAGTGTGAGGTTGATG
CCTTATTAGAACGTCAGAAAAGAGAAGCTATGCCCAATCCAAAGACTTCTTCTAG
CAAACGACAAGTAGATCCAGAGTTTGCAGATATGATAACTGTACAAGAATTCTGC
AAAGCAGAAGAGGTTGATGAAGATAGTGTCTATGGTGTATTTGTCTCTTATATTG
AAATATATAATAATTACATATATGATCTATTGGAAGAGGTGCCGTTTGATCCCAT
AAAACCCAAACCTCCACAATCTAAATTGCTTCGTGAAGATAAGAACCATAACATG
TATGTTGCAGGATGTACAGAAGTTGAAGTGAAATCTACTGAGGAGGCTTTTGAAG
TTTTCTGGAGAGGCCAGAAAAAGAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.