Search our product database

Search options:
Product name: hTRAPPC6A €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06618-1
Sigma Product ID: EHU066181
Species: Homo sapiens
Ensembl Gene ID: ENSG00000007255
Ensembl Transcript ID: ENST00000006275, ENST00000585934, ENST00000588062
Gene coordinates (GRCh38): 19:45162928-45178237
HGNC Alias: HSPC289, MGC2650, TRS33
HGNC ID: HGNC:23069
HGNC Symbol: TRAPPC6A
NCBI gene: 79090
RefSeq mRNA: NM_001270891, NM_001270893, NM_024108
Sequence:TCTTGTGCAAAGACCTGTGGGTGGCGGTGTTCCAGAAGCAGATGGACAGCCTGCG
CACCAATCACCAGGGGACCTACGTCCTGCAAGACAACAGCTTCCCCCTCCTCCTC
CCGATGGCCTCTGGCCTGCAGTATCTGGAGGAAGCACCCAAGTTCCTGGCCTTCA
CCTGCGGCCTCCTGCGCGGCGCCCTCTATACCCTGGGCATTGAGAGCGTGGTCAC
CGCCTCCGTGGCAGCCCTGCCCGTCTGTAAGTTCCAGGTGGTGATTCCGAAATCC
TAAGCCTGCCTCGCACCTGCTGAGCCGCACTGCTGCCCCTGGCCTCACCGGCCTC
AGGAGACGGTGGGGCCGCTGCATTTCGGGGTGGTCTTGGGAATCCCAGGCCCTAG
GGGTCACATTTGCTCAGGAAGTGGGTATCA
Product name: hTRAPPC6A €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06618-1
Sigma Product ID: EHU066181
Species: Homo sapiens
Ensembl Gene ID: ENSG00000007255
Ensembl Transcript ID: ENST00000006275, ENST00000585934, ENST00000588062
Gene coordinates (GRCh38): 19:45162928-45178237
HGNC Alias: HSPC289, MGC2650, TRS33
HGNC ID: HGNC:23069
HGNC Symbol: TRAPPC6A
NCBI gene: 79090
RefSeq mRNA: NM_001270891, NM_001270893, NM_024108
Sequence:TCTTGTGCAAAGACCTGTGGGTGGCGGTGTTCCAGAAGCAGATGGACAGCCTGCG
CACCAATCACCAGGGGACCTACGTCCTGCAAGACAACAGCTTCCCCCTCCTCCTC
CCGATGGCCTCTGGCCTGCAGTATCTGGAGGAAGCACCCAAGTTCCTGGCCTTCA
CCTGCGGCCTCCTGCGCGGCGCCCTCTATACCCTGGGCATTGAGAGCGTGGTCAC
CGCCTCCGTGGCAGCCCTGCCCGTCTGTAAGTTCCAGGTGGTGATTCCGAAATCC
TAAGCCTGCCTCGCACCTGCTGAGCCGCACTGCTGCCCCTGGCCTCACCGGCCTC
AGGAGACGGTGGGGCCGCTGCATTTCGGGGTGGTCTTGGGAATCCCAGGCCCTAG
GGGTCACATTTGCTCAGGAAGTGGGTATCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.