Search our product database

Search options:
Product name: hARID1A €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06662-1
Sigma Product ID: EHU066621
Species: Homo sapiens
Ensembl Gene ID: ENSG00000117713
Ensembl Transcript ID: ENST00000324856, ENST00000374152, ENST00000430799, ENST00000457599, ENST00000466382, ENST00000532781, ENST00000636219
Gene coordinates (GRCh38): 1:26693236-26782110
HGNC Alias: B120, BAF250, BAF250a, C10rf4, C1orf4, P270, SMARCF1
HGNC ID: HGNC:11110
HGNC Symbol: ARID1A
NCBI gene: 8289
RefSeq mRNA: NM_006015, NM_139135
Sequence:CCCTCAAGTCTGGTCTCCTGGCAGAGAGCACATGGGCATTAGATACCATCAACAT
CCTGCTGTATGATGACAACAGCATCATGACCTTCAACCTCAGTCAGCTCCCAGGG
TTGCTAGAGCTCCTTGTAGAATATTTCCGACGATGCCTGATTGAGATCTTTGGCA
TTTTAAAGGAGTATGAGGTGGGTGACCCAGGACAGAGAACGCTACTGGATCCTGG
GAGGTTCAGCAAGGTGTCTAGTCCAGCTCCCATGGAGGGTGGGGAAGAAGAAGAA
GAACTTCTAGGTCCTAAACTAGAAGAGGAAGAAGAAGAGGAAGTAGTTGAAAATG
ATGAGGAGATAGCCTTTTCAGGCAAGGACAAGCCAGCTTCAGAGAATAGTGAGGA
GAAGCTGATCAGTAAGTTTGACAAGCTTCCAGTAAAGATCGTACAGAAGAATGAT
CCATTTGTGGTGGACTGCTCAGA
Product name: hARID1A €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06662-1
Sigma Product ID: EHU066621
Species: Homo sapiens
Ensembl Gene ID: ENSG00000117713
Ensembl Transcript ID: ENST00000324856, ENST00000374152, ENST00000430799, ENST00000457599, ENST00000466382, ENST00000532781, ENST00000636219
Gene coordinates (GRCh38): 1:26693236-26782110
HGNC Alias: B120, BAF250, BAF250a, C10rf4, C1orf4, P270, SMARCF1
HGNC ID: HGNC:11110
HGNC Symbol: ARID1A
NCBI gene: 8289
RefSeq mRNA: NM_006015, NM_139135
Sequence:CCCTCAAGTCTGGTCTCCTGGCAGAGAGCACATGGGCATTAGATACCATCAACAT
CCTGCTGTATGATGACAACAGCATCATGACCTTCAACCTCAGTCAGCTCCCAGGG
TTGCTAGAGCTCCTTGTAGAATATTTCCGACGATGCCTGATTGAGATCTTTGGCA
TTTTAAAGGAGTATGAGGTGGGTGACCCAGGACAGAGAACGCTACTGGATCCTGG
GAGGTTCAGCAAGGTGTCTAGTCCAGCTCCCATGGAGGGTGGGGAAGAAGAAGAA
GAACTTCTAGGTCCTAAACTAGAAGAGGAAGAAGAAGAGGAAGTAGTTGAAAATG
ATGAGGAGATAGCCTTTTCAGGCAAGGACAAGCCAGCTTCAGAGAATAGTGAGGA
GAAGCTGATCAGTAAGTTTGACAAGCTTCCAGTAAAGATCGTACAGAAGAATGAT
CCATTTGTGGTGGACTGCTCAGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.