Search our product database

Search options:
Product name: hEZR €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06684-1
Sigma Product ID: EHU066841
Species: Homo sapiens
Ensembl Gene ID: ENSG00000092820
Ensembl Transcript ID: ENST00000337147, ENST00000367075, ENST00000392177
Gene coordinates (GRCh38): 6:158765741-158819412
HGNC Alias: VIL2
HGNC ID: HGNC:12691
HGNC Symbol: EZR
NCBI gene: 7430
RefSeq mRNA: NM_001111077, NM_003379
Sequence:CCCTCAGATCCCAGTTCCTTTAGAAAGCAGTTACCCAACAGAAACATTCTGGGCT
GGGAACCAGGGAGGCGCCCTGGTTTGTTTTCCCCAGTTGTAATAGTGCCAAGCAG
GCCTGATTCTCGCGATTATTCTCGAATCACCTCCTGTGTTGTGCTGGGAGCAGGA
CTGATTGAATTACGGAAAATGCCTGTAAAGTCTGAGTAAGAAACTTCATGCTGGC
CTGTGTGATACAAGAGTCAGCATCATTAAAGGAAACGTGGCAGGACTTCCATCTG
TGCCATACTTGTTCTGTATTCGAAATGAGCTCAAATTGATTTTTTAATTTCTATG
AAGGATCCATCTTTGTATATTTACATGCTTAGAGGGGTGAAAATTATTTTGGAAA
TTGAGTCTGAAGCACTCTCGCACACACAG
Product name: hEZR €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06684-1
Sigma Product ID: EHU066841
Species: Homo sapiens
Ensembl Gene ID: ENSG00000092820
Ensembl Transcript ID: ENST00000337147, ENST00000367075, ENST00000392177
Gene coordinates (GRCh38): 6:158765741-158819412
HGNC Alias: VIL2
HGNC ID: HGNC:12691
HGNC Symbol: EZR
NCBI gene: 7430
RefSeq mRNA: NM_001111077, NM_003379
Sequence:CCCTCAGATCCCAGTTCCTTTAGAAAGCAGTTACCCAACAGAAACATTCTGGGCT
GGGAACCAGGGAGGCGCCCTGGTTTGTTTTCCCCAGTTGTAATAGTGCCAAGCAG
GCCTGATTCTCGCGATTATTCTCGAATCACCTCCTGTGTTGTGCTGGGAGCAGGA
CTGATTGAATTACGGAAAATGCCTGTAAAGTCTGAGTAAGAAACTTCATGCTGGC
CTGTGTGATACAAGAGTCAGCATCATTAAAGGAAACGTGGCAGGACTTCCATCTG
TGCCATACTTGTTCTGTATTCGAAATGAGCTCAAATTGATTTTTTAATTTCTATG
AAGGATCCATCTTTGTATATTTACATGCTTAGAGGGGTGAAAATTATTTTGGAAA
TTGAGTCTGAAGCACTCTCGCACACACAG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.