Search our product database

Search options:
Product name: hANAPC5 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06969-1
Sigma Product ID: EHU069691
Species: Homo sapiens
Ensembl Gene ID: ENSG00000089053
Ensembl Transcript ID: ENST00000261819, ENST00000441917, ENST00000534976, ENST00000535482, ENST00000535641, ENST00000539079, ENST00000541887, ENST00000544314, ENST00000545218
Gene coordinates (GRCh38): 12:121308245-121399896
HGNC Alias: APC5
HGNC ID: HGNC:15713
HGNC Symbol: ANAPC5
NCBI gene: 51433
RefSeq mRNA: NM_001137559, NM_001330489, NM_016237
Sequence:CTGATGGATGCCCTAAAGGACTCCGACCTCCTGCACTGGAAACACAGCCTGTCAG
AGCTCATCGATATCAGCATCGCACAGAAAACGGCCATCTGGAGGCTGTATGGCCG
CAGCACCATGGCACTGCAACAGGCCCAGATGTTGCTGAGCATGAACAGCCTGGAG
GCGGTGAATGCGGGCGTGCAGCAGAACAACACAGAGTCCTTTGCTGTCGCACTCT
GCCACCTCGCAGAGCTACACGCGGAGCAGGGCTGTTTTGCTGCAGCTTCTGAAGT
GTTAAAGCACTTGAAGGAACGATTTCCGCCTAATAGTCAGCACGCCCAGTTATGG
ATGCTATGTGATCAAAAAATACAGTTTGACAGAGCAATGAATGATGGCAAATATC
ATTTGGCTGATTCACTTGTTACAGGAATCACAGCTCTCAATAGCATAGAGGGTGT
TTATAGGAAAGCGGTTG
Product name: hANAPC5 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-06969-1
Sigma Product ID: EHU069691
Species: Homo sapiens
Ensembl Gene ID: ENSG00000089053
Ensembl Transcript ID: ENST00000261819, ENST00000441917, ENST00000534976, ENST00000535482, ENST00000535641, ENST00000539079, ENST00000541887, ENST00000544314, ENST00000545218
Gene coordinates (GRCh38): 12:121308245-121399896
HGNC Alias: APC5
HGNC ID: HGNC:15713
HGNC Symbol: ANAPC5
NCBI gene: 51433
RefSeq mRNA: NM_001137559, NM_001330489, NM_016237
Sequence:CTGATGGATGCCCTAAAGGACTCCGACCTCCTGCACTGGAAACACAGCCTGTCAG
AGCTCATCGATATCAGCATCGCACAGAAAACGGCCATCTGGAGGCTGTATGGCCG
CAGCACCATGGCACTGCAACAGGCCCAGATGTTGCTGAGCATGAACAGCCTGGAG
GCGGTGAATGCGGGCGTGCAGCAGAACAACACAGAGTCCTTTGCTGTCGCACTCT
GCCACCTCGCAGAGCTACACGCGGAGCAGGGCTGTTTTGCTGCAGCTTCTGAAGT
GTTAAAGCACTTGAAGGAACGATTTCCGCCTAATAGTCAGCACGCCCAGTTATGG
ATGCTATGTGATCAAAAAATACAGTTTGACAGAGCAATGAATGATGGCAAATATC
ATTTGGCTGATTCACTTGTTACAGGAATCACAGCTCTCAATAGCATAGAGGGTGT
TTATAGGAAAGCGGTTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.