Search our product database

Search options:
Product name: hMTRR €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07055-1
Sigma Product ID: EHU070551
Species: Homo sapiens
Ensembl Gene ID: ENSG00000124275
Ensembl Transcript ID: ENST00000264668, ENST00000440940, ENST00000510525, ENST00000511461, ENST00000513439
Gene coordinates (GRCh38): 5:7851186-7906025
HGNC Alias: cblE
HGNC ID: HGNC:7473
HGNC Symbol: MTRR
NCBI gene: 4552
RefSeq mRNA: NM_001364440, NM_001364441, NM_001364442, NM_002454, NM_024010
RefSeq ncRNA: NR_134480, NR_134481, NR_134482, NR_157168, NR_157169, NR_157170, NR_157171, NR_157172, NR_157173, NR_157174, NR_157175, NR_157176, NR_157177, NR_157178
Sequence:TCCTGCTCGAACATCTTCCTAAACTTCAACCCAGACCATATTCGTGTGCAAGCTC
AAGTTTATTTCACCCAGGAAAGCTCCATTTTGTCTTCAACATTGTGGAATTTCTG
TCTACTGCCACAACAGAGGTTCTGCGGAAGGGAGTATGTACAGGCTGGCTGGCCT
TGTTGGTTGCTTCAGTTCTTCAGCCAAACATACATGCATCCCATGAAGACAGCGG
GAAAGCCCTGGCTCCTAAGATATCCATCTCTCCTCGAACAACAAATTCTTTCCAC
TTACCAGATGACCCCTCAATCCCCATCATAATGGTGGGTCCAGGAACCGGCATAG
CCCCGTTTATTGGGTTCCTACAACATAGAGAGAAACTCCAAGAACAACACCCAGA
TGGAAATTTTGGAGCAATGTGGTTGT
Product name: hMTRR €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07055-1
Sigma Product ID: EHU070551
Species: Homo sapiens
Ensembl Gene ID: ENSG00000124275
Ensembl Transcript ID: ENST00000264668, ENST00000440940, ENST00000510525, ENST00000511461, ENST00000513439
Gene coordinates (GRCh38): 5:7851186-7906025
HGNC Alias: cblE
HGNC ID: HGNC:7473
HGNC Symbol: MTRR
NCBI gene: 4552
RefSeq mRNA: NM_001364440, NM_001364441, NM_001364442, NM_002454, NM_024010
RefSeq ncRNA: NR_134480, NR_134481, NR_134482, NR_157168, NR_157169, NR_157170, NR_157171, NR_157172, NR_157173, NR_157174, NR_157175, NR_157176, NR_157177, NR_157178
Sequence:TCCTGCTCGAACATCTTCCTAAACTTCAACCCAGACCATATTCGTGTGCAAGCTC
AAGTTTATTTCACCCAGGAAAGCTCCATTTTGTCTTCAACATTGTGGAATTTCTG
TCTACTGCCACAACAGAGGTTCTGCGGAAGGGAGTATGTACAGGCTGGCTGGCCT
TGTTGGTTGCTTCAGTTCTTCAGCCAAACATACATGCATCCCATGAAGACAGCGG
GAAAGCCCTGGCTCCTAAGATATCCATCTCTCCTCGAACAACAAATTCTTTCCAC
TTACCAGATGACCCCTCAATCCCCATCATAATGGTGGGTCCAGGAACCGGCATAG
CCCCGTTTATTGGGTTCCTACAACATAGAGAGAAACTCCAAGAACAACACCCAGA
TGGAAATTTTGGAGCAATGTGGTTGT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.