Search our product database

Search options:
Product name: hEGFL7 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07149-1
Sigma Product ID: EHU071491
Species: Homo sapiens
Ensembl Gene ID: ENSG00000172889
Ensembl Transcript ID: ENST00000308874, ENST00000371698, ENST00000371699, ENST00000406555
Gene coordinates (GRCh38): 9:136658856-136672678
HGNC Alias: ZNEU1
HGNC ID: HGNC:20594
HGNC Symbol: EGFL7
NCBI gene: 51162
RefSeq mRNA: NM_016215, NM_201446
RefSeq ncRNA: NR_045110, NR_045111, NR_046367
Sequence:GAACGGAGGGAGCTGTGTCCAGCCTGGCCGCTGCCGCTGCCCTGCAGGATGGCGG
GGTGACACTTGCCAGTCAGATGTGGATGAATGCAGTGCTAGGAGGGGCGGCTGTC
CCCAGCGCTGCGTCAACACCGCCGGCAGTTACTGGTGCCAGTGTTGGGAGGGGCA
CAGCCTGTCTGCAGACGGTACACTCTGTGTGCCCAAGGGAGGGCCCCCCAGGGTG
GCCCCCAACCCGACAGGAGTGGACAGTGCAATGAAGGAAGAAGTGCAGAGGCTGC
AGTCCAGGGTGGACCTGCTGGAGGAGAAGCTGCAGCTGGTGCTGGCCCCACTGCA
CAGCCTGGCCTCGCAGGCACTGGAGCATGGGCTCCCGGACCCCGGCAGCCTCCTG
GTGCACTCCTTCCAGCAGCTCGGCCGCATCGACTCCCTGAGCGAGCAGATTTCCT
TCCTGGAGGAGC
Product name: hEGFL7 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07149-1
Sigma Product ID: EHU071491
Species: Homo sapiens
Ensembl Gene ID: ENSG00000172889
Ensembl Transcript ID: ENST00000308874, ENST00000371698, ENST00000371699, ENST00000406555
Gene coordinates (GRCh38): 9:136658856-136672678
HGNC Alias: ZNEU1
HGNC ID: HGNC:20594
HGNC Symbol: EGFL7
NCBI gene: 51162
RefSeq mRNA: NM_016215, NM_201446
RefSeq ncRNA: NR_045110, NR_045111, NR_046367
Sequence:GAACGGAGGGAGCTGTGTCCAGCCTGGCCGCTGCCGCTGCCCTGCAGGATGGCGG
GGTGACACTTGCCAGTCAGATGTGGATGAATGCAGTGCTAGGAGGGGCGGCTGTC
CCCAGCGCTGCGTCAACACCGCCGGCAGTTACTGGTGCCAGTGTTGGGAGGGGCA
CAGCCTGTCTGCAGACGGTACACTCTGTGTGCCCAAGGGAGGGCCCCCCAGGGTG
GCCCCCAACCCGACAGGAGTGGACAGTGCAATGAAGGAAGAAGTGCAGAGGCTGC
AGTCCAGGGTGGACCTGCTGGAGGAGAAGCTGCAGCTGGTGCTGGCCCCACTGCA
CAGCCTGGCCTCGCAGGCACTGGAGCATGGGCTCCCGGACCCCGGCAGCCTCCTG
GTGCACTCCTTCCAGCAGCTCGGCCGCATCGACTCCCTGAGCGAGCAGATTTCCT
TCCTGGAGGAGC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.