Search our product database

Search options:
Product name: hVCP €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07199-1
Sigma Product ID: EHU071991
Species: Homo sapiens
Ensembl Gene ID: ENSG00000165280
Ensembl Transcript ID: ENST00000358901, ENST00000417448, ENST00000448530, ENST00000493886
Gene coordinates (GRCh38): 9:35056064-35073249
HGNC Alias: CDC48, IBMPFD, p97, TERA
HGNC ID: HGNC:12666
HGNC Symbol: VCP
NCBI gene: 7415
RefSeq mRNA: NM_001354927, NM_001354928, NM_007126
Sequence:TGAAGCCATCAATGAGGACAACAGTGTGGTGTCCTTGTCCCAGCCCAAGATGGAT
GAATTGCAGTTGTTCCGAGGTGACACAGTGTTGCTGAAAGGAAAGAAGAGACGAG
AAGCTGTTTGCATCGTCCTTTCTGATGATACTTGTTCTGATGAGAAGATTCGGAT
GAATAGAGTTGTTCGGAATAACCTTCGTGTACGCCTAGGGGATGTCATCAGCATC
CAGCCATGCCCTGATGTGAAGTACGGCAAACGTATCCATGTGCTGCCCATTGATG
ACACAGTGGAAGGCATTACTGGTAATCTCTTCGAGGTATACCTTAAGCCGTACTT
CCTGGAAGCGTATCGACCCATCCGGAAAGGAGACATTTTTCTTGTCCGTGGTGGG
ATGCGTGCTGTGGAGTTCAAAGTGG
Product name: hVCP €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07199-1
Sigma Product ID: EHU071991
Species: Homo sapiens
Ensembl Gene ID: ENSG00000165280
Ensembl Transcript ID: ENST00000358901, ENST00000417448, ENST00000448530, ENST00000493886
Gene coordinates (GRCh38): 9:35056064-35073249
HGNC Alias: CDC48, IBMPFD, p97, TERA
HGNC ID: HGNC:12666
HGNC Symbol: VCP
NCBI gene: 7415
RefSeq mRNA: NM_001354927, NM_001354928, NM_007126
Sequence:TGAAGCCATCAATGAGGACAACAGTGTGGTGTCCTTGTCCCAGCCCAAGATGGAT
GAATTGCAGTTGTTCCGAGGTGACACAGTGTTGCTGAAAGGAAAGAAGAGACGAG
AAGCTGTTTGCATCGTCCTTTCTGATGATACTTGTTCTGATGAGAAGATTCGGAT
GAATAGAGTTGTTCGGAATAACCTTCGTGTACGCCTAGGGGATGTCATCAGCATC
CAGCCATGCCCTGATGTGAAGTACGGCAAACGTATCCATGTGCTGCCCATTGATG
ACACAGTGGAAGGCATTACTGGTAATCTCTTCGAGGTATACCTTAAGCCGTACTT
CCTGGAAGCGTATCGACCCATCCGGAAAGGAGACATTTTTCTTGTCCGTGGTGGG
ATGCGTGCTGTGGAGTTCAAAGTGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.