Search our product database

Search options:
Product name: hTUBGCP3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07329-1
Sigma Product ID: EHU073291
Species: Homo sapiens
Ensembl Gene ID: ENSG00000126216
Ensembl Transcript ID: ENST00000261965, ENST00000375669, ENST00000649778
Gene coordinates (GRCh38): 13:112485005-112588205
HGNC Alias: GCP3, SPBC98, Spc98p
HGNC ID: HGNC:18598
HGNC Symbol: TUBGCP3
NCBI gene: 10426
RefSeq mRNA: NM_001286277, NM_001286278, NM_006322
Sequence:GGATGTCTTCAGCCTCGATTATCATGTTGACGGACCAATTGCAACTGTGTTTACT
CGAGAATGTATGAGCCACTACCTAAGAGTATTTAACTTCCTCTGGAGGGCGAAGC
GGATGGAATACATCCTCACTGACATACGGAAGGGACACATGTGCAATGCAAAGCT
CCTGAGAAACATGCCAGAGTTCTCCGGGGTGCTGCACCAGTGTCACATTTTGGCC
TCTGAGATGGTCCATTTCATTCATCAGATGCAGTATTACATCACATTTGAGGTGC
TTGAATGTTCTTGGGATGAGCTTTGGAACAAAGTCCAGCAGGCCCAGGATTTGGA
TCACATCATTGCTGCACACGAGGTGTTCTTAGACACCATCATCTCCCGCTGCCTG
CTGGACAGTGACTCCAGGGCACTT
Product name: hTUBGCP3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07329-1
Sigma Product ID: EHU073291
Species: Homo sapiens
Ensembl Gene ID: ENSG00000126216
Ensembl Transcript ID: ENST00000261965, ENST00000375669, ENST00000649778
Gene coordinates (GRCh38): 13:112485005-112588205
HGNC Alias: GCP3, SPBC98, Spc98p
HGNC ID: HGNC:18598
HGNC Symbol: TUBGCP3
NCBI gene: 10426
RefSeq mRNA: NM_001286277, NM_001286278, NM_006322
Sequence:GGATGTCTTCAGCCTCGATTATCATGTTGACGGACCAATTGCAACTGTGTTTACT
CGAGAATGTATGAGCCACTACCTAAGAGTATTTAACTTCCTCTGGAGGGCGAAGC
GGATGGAATACATCCTCACTGACATACGGAAGGGACACATGTGCAATGCAAAGCT
CCTGAGAAACATGCCAGAGTTCTCCGGGGTGCTGCACCAGTGTCACATTTTGGCC
TCTGAGATGGTCCATTTCATTCATCAGATGCAGTATTACATCACATTTGAGGTGC
TTGAATGTTCTTGGGATGAGCTTTGGAACAAAGTCCAGCAGGCCCAGGATTTGGA
TCACATCATTGCTGCACACGAGGTGTTCTTAGACACCATCATCTCCCGCTGCCTG
CTGGACAGTGACTCCAGGGCACTT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.