Search our product database

Search options:
Product name: hMAD2L1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07461-1
Sigma Product ID: EHU074611
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164109
Ensembl Transcript ID: ENST00000296509, ENST00000333047
Gene coordinates (GRCh38): 4:120055608-120067074
HGNC Alias: HSMAD2, MAD2
HGNC ID: HGNC:6763
HGNC Symbol: MAD2L1
NCBI gene: 4085
RefSeq mRNA: NM_002358
Sequence:GGTACCTATTTGACTTACCATGGAGTTAACATCATGAATTTATTGCACATTGTTC
AAAAGGAACCAGGAGGTTTTTTTGTCAACATTGTGATGTATATTCCTTTGAAGAT
AGTAACTGTAGATGGAAAAACTTGTGCTATAAAGCTAGATGCTTTCCTAAATCAG
ATGTTTTGGTCAAGTAGTTTGACTCAGTATAGGTAGGGAGATATTTAAGTATAAA
ATACAACAAAGGAAGTCTAAATATTCAGAATCTTTGTTAAGGTCCTGAAAGTAAC
TCATAATCTATAAACAATGAAATATTGCTGTATAGCTCCTTTTGACCTTCATTTC
ATGTATAGTTTTCCCTATTGAATCAGTTTCCAATTATTTGACTTTAATTTATGTA
ACTTGAACCTATGAAGCAATGGA
Product name: hMAD2L1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07461-1
Sigma Product ID: EHU074611
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164109
Ensembl Transcript ID: ENST00000296509, ENST00000333047
Gene coordinates (GRCh38): 4:120055608-120067074
HGNC Alias: HSMAD2, MAD2
HGNC ID: HGNC:6763
HGNC Symbol: MAD2L1
NCBI gene: 4085
RefSeq mRNA: NM_002358
Sequence:GGTACCTATTTGACTTACCATGGAGTTAACATCATGAATTTATTGCACATTGTTC
AAAAGGAACCAGGAGGTTTTTTTGTCAACATTGTGATGTATATTCCTTTGAAGAT
AGTAACTGTAGATGGAAAAACTTGTGCTATAAAGCTAGATGCTTTCCTAAATCAG
ATGTTTTGGTCAAGTAGTTTGACTCAGTATAGGTAGGGAGATATTTAAGTATAAA
ATACAACAAAGGAAGTCTAAATATTCAGAATCTTTGTTAAGGTCCTGAAAGTAAC
TCATAATCTATAAACAATGAAATATTGCTGTATAGCTCCTTTTGACCTTCATTTC
ATGTATAGTTTTCCCTATTGAATCAGTTTCCAATTATTTGACTTTAATTTATGTA
ACTTGAACCTATGAAGCAATGGA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.