Search our product database

Search options:
Product name: hADAM17 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07538-1
Sigma Product ID: EHU075381
Species: Homo sapiens
Ensembl Gene ID: ENSG00000151694
Ensembl Transcript ID: ENST00000310823, ENST00000497134, ENST00000618923, ENST00000647622, ENST00000648548, ENST00000648857, ENST00000649227, ENST00000649686, ENST00000649972, ENST00000650116, ENST00000650241
Gene coordinates (GRCh38): 2:9488486-9556732
HGNC Alias: CD156B, cSVP, TACE
HGNC ID: HGNC:195
HGNC Symbol: ADAM17
NCBI gene: 6868
RefSeq mRNA: NM_003183
Sequence:TGGTTGGTGAGCCTGACTCTAGGGTTCTAGCCCACATAAGAGATGATGATGTTAT
AATCAGAATCAACACAGATGGGGCCGAATATAACATAGAGCCACTTTGGAGATTT
GTTAATGATACCAAAGACAAAAGAATGTTAGTTTATAAATCTGAAGATATCAAGA
ATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATTTAAAAGTGGATAATGA
AGAGTTGCTCCCAAAAGGGTTAGTAGACAGAGAACCACCTGAAGAGCTTGTTCAT
CGAGTGAAAAGAAGAGCTGACCCAGATCCCATGAAGAACACGTGTAAATTATTGG
TGGTAGCAGATCATCGCTTCTACAGATACATGGGCAGAGGGGAAGAGAGTACAAC
TACAAATTACTTAATAGAGCTAATTGACAGAGTTGATGACATCTATCGGAACACT
TCATGGG
Product name: hADAM17 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07538-1
Sigma Product ID: EHU075381
Species: Homo sapiens
Ensembl Gene ID: ENSG00000151694
Ensembl Transcript ID: ENST00000310823, ENST00000497134, ENST00000618923, ENST00000647622, ENST00000648548, ENST00000648857, ENST00000649227, ENST00000649686, ENST00000649972, ENST00000650116, ENST00000650241
Gene coordinates (GRCh38): 2:9488486-9556732
HGNC Alias: CD156B, cSVP, TACE
HGNC ID: HGNC:195
HGNC Symbol: ADAM17
NCBI gene: 6868
RefSeq mRNA: NM_003183
Sequence:TGGTTGGTGAGCCTGACTCTAGGGTTCTAGCCCACATAAGAGATGATGATGTTAT
AATCAGAATCAACACAGATGGGGCCGAATATAACATAGAGCCACTTTGGAGATTT
GTTAATGATACCAAAGACAAAAGAATGTTAGTTTATAAATCTGAAGATATCAAGA
ATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATTTAAAAGTGGATAATGA
AGAGTTGCTCCCAAAAGGGTTAGTAGACAGAGAACCACCTGAAGAGCTTGTTCAT
CGAGTGAAAAGAAGAGCTGACCCAGATCCCATGAAGAACACGTGTAAATTATTGG
TGGTAGCAGATCATCGCTTCTACAGATACATGGGCAGAGGGGAAGAGAGTACAAC
TACAAATTACTTAATAGAGCTAATTGACAGAGTTGATGACATCTATCGGAACACT
TCATGGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.