Search our product database

Search options:
Product name: hAL358113.1,TJP2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07563-1
Sigma Product ID: EHU075631
Species: Homo sapiens
Ensembl Gene ID: ENSG00000119139, ENSG00000285130
Ensembl Transcript ID: ENST00000348208, ENST00000377245, ENST00000453658, ENST00000535702, ENST00000539225, ENST00000636247, ENST00000636438, ENST00000642889, ENST00000643352, ENST00000645088, ENST00000647986, ENST00000648087, ENST00000648153, ENST00000648204, ENST00000649114, ENST00000649134, ENST00000649783, ENST00000649943, ENST00000650084, ENST00000650333, ENST00000650460
Gene coordinates (GRCh38): 9:69035750-69255187, 9:69121264-69274615
HGNC Alias: DFNA51, X104, ZO-2, ZO2
HGNC ID: HGNC:11828
HGNC Symbol: TJP2
NCBI gene: 9414
RefSeq mRNA: NM_001170414, NM_001170415, NM_001170416, NM_004817, NM_201629
Sequence:GCTTGGGAGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAA
GATGGCAACCTTCACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTG
AGAACATGTCTTTAACGGATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACT
ACAGCTAGTGGTGTTGAGAGACAGCCAGCAGACCCTCATCAACATCCCGTCATTA
AATGACAGTGACTCAGAAATAGAAGATATTTCAGAAATAGAGTCAAACCGATCAT
TTTCTCCAGAGGAGAGACGTCATCAGTATTCTGATTATGATTATCATTCCTCAAG
TGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGACACGCCGAGCAGATTGTCC
AGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGATATTGCAGGCACAG
TTGTCC
Product name: hAL358113.1,TJP2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07563-1
Sigma Product ID: EHU075631
Species: Homo sapiens
Ensembl Gene ID: ENSG00000119139, ENSG00000285130
Ensembl Transcript ID: ENST00000348208, ENST00000377245, ENST00000453658, ENST00000535702, ENST00000539225, ENST00000636247, ENST00000636438, ENST00000642889, ENST00000643352, ENST00000645088, ENST00000647986, ENST00000648087, ENST00000648153, ENST00000648204, ENST00000649114, ENST00000649134, ENST00000649783, ENST00000649943, ENST00000650084, ENST00000650333, ENST00000650460
Gene coordinates (GRCh38): 9:69035750-69255187, 9:69121264-69274615
HGNC Alias: DFNA51, X104, ZO-2, ZO2
HGNC ID: HGNC:11828
HGNC Symbol: TJP2
NCBI gene: 9414
RefSeq mRNA: NM_001170414, NM_001170415, NM_001170416, NM_004817, NM_201629
Sequence:GCTTGGGAGTCAGATCTTCGTAAAGGAAATGACCCGAACGGGTCTGGCAACTAAA
GATGGCAACCTTCACGAAGGAGACATAATTCTCAAGATCAATGGGACTGTAACTG
AGAACATGTCTTTAACGGATGCTCGAAAATTGATAGAAAAGTCAAGAGGAAAACT
ACAGCTAGTGGTGTTGAGAGACAGCCAGCAGACCCTCATCAACATCCCGTCATTA
AATGACAGTGACTCAGAAATAGAAGATATTTCAGAAATAGAGTCAAACCGATCAT
TTTCTCCAGAGGAGAGACGTCATCAGTATTCTGATTATGATTATCATTCCTCAAG
TGAGAAGCTGAAGGAAAGGCCAAGTTCCAGAGAGGACACGCCGAGCAGATTGTCC
AGGATGGGTGCGACACCCACTCCCTTTAAGTCCACAGGGGATATTGCAGGCACAG
TTGTCC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.