Search our product database

Search options:
Product name: hPCDH7 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07763-1
Sigma Product ID: EHU077631
Species: Homo sapiens
Ensembl Gene ID: ENSG00000169851
Ensembl Transcript ID: ENST00000361762, ENST00000511884, ENST00000543491, ENST00000621961
Gene coordinates (GRCh38): 4:30720415-31146805
HGNC Alias: BH-Pcdh, PPP1R120
HGNC ID: HGNC:8659
HGNC Symbol: PCDH7
NCBI gene: 5099
RefSeq mRNA: NM_001173523, NM_002589, NM_032456, NM_032457
Sequence:TGCTCCCACAGTTACCCTTCCCAAAAACATTTCCTACACTTTACTGCCACCTTCG
AGTAATGTCAGGACAGTAGTAGCTACAGTGTTGGCAACAGACAGTGATGATGGCA
TCAATGCAGACCTGAACTACAGCATTGTGGGAGGAAATCCCTTCAAGCTGTTTGA
AATTGATCCCACTAGTGGTGTGGTTTCCTTAGTGGGAAAACTCACCCAAAAGCAT
TATGGCTTGCACAGGTTGGTGGTGCAAGTGAATGACAGTGGGCAGCCTTCCCAGT
CCACCACGACTCTGGTGCACGTGTTTGTCAATGAAAGTGTTTCTAATGCAACTGC
GATTGACTCCCAGATAGCTAGAAGTTTGCACATCCCACTCACCCAGGATATAGCT
GGTGACCCAAGCTATGAAATTAGCAAACAGAGACTCAGTATTGTCATTGGCGTGG
TTG
Product name: hPCDH7 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07763-1
Sigma Product ID: EHU077631
Species: Homo sapiens
Ensembl Gene ID: ENSG00000169851
Ensembl Transcript ID: ENST00000361762, ENST00000511884, ENST00000543491, ENST00000621961
Gene coordinates (GRCh38): 4:30720415-31146805
HGNC Alias: BH-Pcdh, PPP1R120
HGNC ID: HGNC:8659
HGNC Symbol: PCDH7
NCBI gene: 5099
RefSeq mRNA: NM_001173523, NM_002589, NM_032456, NM_032457
Sequence:TGCTCCCACAGTTACCCTTCCCAAAAACATTTCCTACACTTTACTGCCACCTTCG
AGTAATGTCAGGACAGTAGTAGCTACAGTGTTGGCAACAGACAGTGATGATGGCA
TCAATGCAGACCTGAACTACAGCATTGTGGGAGGAAATCCCTTCAAGCTGTTTGA
AATTGATCCCACTAGTGGTGTGGTTTCCTTAGTGGGAAAACTCACCCAAAAGCAT
TATGGCTTGCACAGGTTGGTGGTGCAAGTGAATGACAGTGGGCAGCCTTCCCAGT
CCACCACGACTCTGGTGCACGTGTTTGTCAATGAAAGTGTTTCTAATGCAACTGC
GATTGACTCCCAGATAGCTAGAAGTTTGCACATCCCACTCACCCAGGATATAGCT
GGTGACCCAAGCTATGAAATTAGCAAACAGAGACTCAGTATTGTCATTGGCGTGG
TTG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.