Search our product database

Search options:
Product name: hNCSTN €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07802-1
Sigma Product ID: EHU078021
Species: Homo sapiens
Ensembl Gene ID: ENSG00000162736
Ensembl Transcript ID: ENST00000294785, ENST00000368063
Gene coordinates (GRCh38): 1:160343272-160358952
HGNC Alias: APH2, KIAA0253
HGNC ID: HGNC:17091
HGNC Symbol: NCSTN
NCBI gene: 23385
RefSeq mRNA: NM_001290184, NM_001290186, NM_001349729, NM_015331
Sequence:TGGAGAAGCTGAAAGGGAGAACCAGCCGAATTGCTGGTCTTGCAGTGTCCTTGAC
CAAGCCCAGTCCTGCCTCAGGCTTCTCTCCTAGTGTACAGTGCCCAAATGATGGG
TTTGGTGTTTACTCCAATTCCTATGGGCCAGAGTTTGCTCACTGCAGAGAAATAC
AGTGGAATTCGCTGGGCAATGGTTTGGCTTATGAAGACTTTAGTTTCCCCATCTT
TCTTCTTGAAGATGAAAATGAAACCAAAGTCATCAAGCAGTGCTATCAAGATCAC
AACCTGAGTCAGAATGGCTCAGCACCAACCTTCCCACTATGTGCCATGCAGCTCT
TTTCACACATGCATGCTGTCATCAGCACTGCCACCTGCATGCGGCGCAGCTCCAT
CCAAAGCACCTTCAGCATCAA
Product name: hNCSTN €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07802-1
Sigma Product ID: EHU078021
Species: Homo sapiens
Ensembl Gene ID: ENSG00000162736
Ensembl Transcript ID: ENST00000294785, ENST00000368063
Gene coordinates (GRCh38): 1:160343272-160358952
HGNC Alias: APH2, KIAA0253
HGNC ID: HGNC:17091
HGNC Symbol: NCSTN
NCBI gene: 23385
RefSeq mRNA: NM_001290184, NM_001290186, NM_001349729, NM_015331
Sequence:TGGAGAAGCTGAAAGGGAGAACCAGCCGAATTGCTGGTCTTGCAGTGTCCTTGAC
CAAGCCCAGTCCTGCCTCAGGCTTCTCTCCTAGTGTACAGTGCCCAAATGATGGG
TTTGGTGTTTACTCCAATTCCTATGGGCCAGAGTTTGCTCACTGCAGAGAAATAC
AGTGGAATTCGCTGGGCAATGGTTTGGCTTATGAAGACTTTAGTTTCCCCATCTT
TCTTCTTGAAGATGAAAATGAAACCAAAGTCATCAAGCAGTGCTATCAAGATCAC
AACCTGAGTCAGAATGGCTCAGCACCAACCTTCCCACTATGTGCCATGCAGCTCT
TTTCACACATGCATGCTGTCATCAGCACTGCCACCTGCATGCGGCGCAGCTCCAT
CCAAAGCACCTTCAGCATCAA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.