Search our product database

Search options:
Product name: hCKAP5 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07822-1
Sigma Product ID: EHU078221
Species: Homo sapiens
Ensembl Gene ID: ENSG00000175216
Ensembl Transcript ID: ENST00000312055, ENST00000354558, ENST00000529230
Gene coordinates (GRCh38): 11:46743048-46846308
HGNC Alias: ch-TOG, KIAA0097, TOG, TOGp
HGNC ID: HGNC:28959
HGNC Symbol: CKAP5
NCBI gene: 9793
RefSeq mRNA: NM_001008938, NM_014756
Sequence:CAAGGAGCTGGGCATAGAGATCTGTCTTATGTACATAGAGATTGAGAAAGGAGAG
GCTGTTCAAGAAGAGCTCCTGAAAGGCTTGGACAATAAGAATCCCAAGATCATAG
TGGCCTGTATAGAGACACTGAGGAAAGCCTTAAGTGAATTTGGTTCCAAAATCAT
CTTGCTTAAGCCAATTATCAAAGTGTTGCCAAAACTCTTTGAGTCTCGAGAGAAG
GCTGTTCGAGATGAAGCCAAACTAATTGCTGTGGAGATTTACAGATGGATTCGGG
ATGCTCTGAGACCCCCATTACAAAATATAAACTCTGTTCAGTTGAAAGAACTAGA
AGAAGAATGGGTCAAACTGCCAACAAGTGCTCCTAGACCTACTCGATTTCTTCGT
TCCCAACAAGAACTAGAAGCTAAATTGGAACAACAACAGTCTGCTGGTGGAGATG
CT
Product name: hCKAP5 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07822-1
Sigma Product ID: EHU078221
Species: Homo sapiens
Ensembl Gene ID: ENSG00000175216
Ensembl Transcript ID: ENST00000312055, ENST00000354558, ENST00000529230
Gene coordinates (GRCh38): 11:46743048-46846308
HGNC Alias: ch-TOG, KIAA0097, TOG, TOGp
HGNC ID: HGNC:28959
HGNC Symbol: CKAP5
NCBI gene: 9793
RefSeq mRNA: NM_001008938, NM_014756
Sequence:CAAGGAGCTGGGCATAGAGATCTGTCTTATGTACATAGAGATTGAGAAAGGAGAG
GCTGTTCAAGAAGAGCTCCTGAAAGGCTTGGACAATAAGAATCCCAAGATCATAG
TGGCCTGTATAGAGACACTGAGGAAAGCCTTAAGTGAATTTGGTTCCAAAATCAT
CTTGCTTAAGCCAATTATCAAAGTGTTGCCAAAACTCTTTGAGTCTCGAGAGAAG
GCTGTTCGAGATGAAGCCAAACTAATTGCTGTGGAGATTTACAGATGGATTCGGG
ATGCTCTGAGACCCCCATTACAAAATATAAACTCTGTTCAGTTGAAAGAACTAGA
AGAAGAATGGGTCAAACTGCCAACAAGTGCTCCTAGACCTACTCGATTTCTTCGT
TCCCAACAAGAACTAGAAGCTAAATTGGAACAACAACAGTCTGCTGGTGGAGATG
CT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.