Search our product database

Search options:
Product name: hVPS41 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07909-1
Sigma Product ID: EHU079091
Species: Homo sapiens
Ensembl Gene ID: ENSG00000006715
Ensembl Transcript ID: ENST00000310301, ENST00000395969, ENST00000482217
Gene coordinates (GRCh38): 7:38722963-38932394
HGNC Alias: HVSP41
HGNC ID: HGNC:12713
HGNC Symbol: VPS41
NCBI gene: 27072
RefSeq mRNA: NM_014396, NM_080631
Sequence:GACAGTACCCATTGCCCACTTGAAAAGGCTCTTGAGATCTGTCAACAGAGAAACT
TTGTAGAAGAGACAGTTTATCTTCTGAGCCGAATGGGTAATAGCCGAAGTGCCCT
GAAGATGATTATGGAGGAATTACATGATGTTGATAAAGCAATCGAATTTGCCAAG
GAGCAAGATGATGGAGAGCTGTGGGAAGATTTGATTTTATATTCCATTGACAAAC
CACCATTTATTACTGGCTTGTTAAACAACATTGGCACACATGTTGACCCAATTCT
ACTGATTCACCGTATTAAGGAAGGAATGGAGATCCCCAATTTGAGAGATTCCTTG
GTTAAAATTCTGCAAGACTACAATTTGCAAATTCTGCTTCGTGAAGGCTGCAAGA
AGATTCTCGTAGCTGACTCTTTGTCCTTACTGAAGAAAATGCACCGAACTCAAAT
G
Product name: hVPS41 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07909-1
Sigma Product ID: EHU079091
Species: Homo sapiens
Ensembl Gene ID: ENSG00000006715
Ensembl Transcript ID: ENST00000310301, ENST00000395969, ENST00000482217
Gene coordinates (GRCh38): 7:38722963-38932394
HGNC Alias: HVSP41
HGNC ID: HGNC:12713
HGNC Symbol: VPS41
NCBI gene: 27072
RefSeq mRNA: NM_014396, NM_080631
Sequence:GACAGTACCCATTGCCCACTTGAAAAGGCTCTTGAGATCTGTCAACAGAGAAACT
TTGTAGAAGAGACAGTTTATCTTCTGAGCCGAATGGGTAATAGCCGAAGTGCCCT
GAAGATGATTATGGAGGAATTACATGATGTTGATAAAGCAATCGAATTTGCCAAG
GAGCAAGATGATGGAGAGCTGTGGGAAGATTTGATTTTATATTCCATTGACAAAC
CACCATTTATTACTGGCTTGTTAAACAACATTGGCACACATGTTGACCCAATTCT
ACTGATTCACCGTATTAAGGAAGGAATGGAGATCCCCAATTTGAGAGATTCCTTG
GTTAAAATTCTGCAAGACTACAATTTGCAAATTCTGCTTCGTGAAGGCTGCAAGA
AGATTCTCGTAGCTGACTCTTTGTCCTTACTGAAGAAAATGCACCGAACTCAAAT
G

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.