Search our product database

Search options:
Product name: hBTBD3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07991-1
Sigma Product ID: EHU079911
Species: Homo sapiens
Ensembl Gene ID: ENSG00000132640
Ensembl Transcript ID: ENST00000254977, ENST00000378226, ENST00000399006, ENST00000405977, ENST00000618296, ENST00000618918
Gene coordinates (GRCh38): 20:11890723-11926609
HGNC Alias: dJ742J24.1, KIAA0952
HGNC ID: HGNC:15854
HGNC Symbol: BTBD3
NCBI gene: 22903
RefSeq mRNA: NM_001282550, NM_001282551, NM_001282552, NM_001282554, NM_014962, NM_181443
Sequence:GTATGGCTCCAGCTGTGGTTCTGCAGAATACAGTGCCAAGATTGAACTTAAGCGG
CAGGGCGTTGTCCTGGGGCAGAACTTGAGCAAGTACTTCTCAGATGGGTCCAGCA
ATACCTTTCCCGTATGGTTTGAATACCCAGTGCAGATCGAGCCAGACACCTTCTA
CACAGCCAGTGTGATACTGGATGGCAATGAACTCAGCTACTTTGGACAAGAAGGC
ATGACAGAAGTTCAGTGTGGCAAAGTGACTGTCCAGTTTCAGTGCTCCTCAGATA
GCACCAATGGCACTGGGGTACAGGGAGGGCAGATCCCTGAACTTATATTCTATGC
TTGAAAACTCACTTCCTGAAGCAGCTTGAGCTCCAAAGTGCACATCTGGTTCCAA
CTTGCCTGATGCTTAGCTCA
Product name: hBTBD3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-07991-1
Sigma Product ID: EHU079911
Species: Homo sapiens
Ensembl Gene ID: ENSG00000132640
Ensembl Transcript ID: ENST00000254977, ENST00000378226, ENST00000399006, ENST00000405977, ENST00000618296, ENST00000618918
Gene coordinates (GRCh38): 20:11890723-11926609
HGNC Alias: dJ742J24.1, KIAA0952
HGNC ID: HGNC:15854
HGNC Symbol: BTBD3
NCBI gene: 22903
RefSeq mRNA: NM_001282550, NM_001282551, NM_001282552, NM_001282554, NM_014962, NM_181443
Sequence:GTATGGCTCCAGCTGTGGTTCTGCAGAATACAGTGCCAAGATTGAACTTAAGCGG
CAGGGCGTTGTCCTGGGGCAGAACTTGAGCAAGTACTTCTCAGATGGGTCCAGCA
ATACCTTTCCCGTATGGTTTGAATACCCAGTGCAGATCGAGCCAGACACCTTCTA
CACAGCCAGTGTGATACTGGATGGCAATGAACTCAGCTACTTTGGACAAGAAGGC
ATGACAGAAGTTCAGTGTGGCAAAGTGACTGTCCAGTTTCAGTGCTCCTCAGATA
GCACCAATGGCACTGGGGTACAGGGAGGGCAGATCCCTGAACTTATATTCTATGC
TTGAAAACTCACTTCCTGAAGCAGCTTGAGCTCCAAAGTGCACATCTGGTTCCAA
CTTGCCTGATGCTTAGCTCA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.