Search our product database

Search options:
Product name: hBTG3 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08004-1
Sigma Product ID: EHU080041
Species: Homo sapiens
Ensembl Gene ID: ENSG00000154640
Ensembl Transcript ID: ENST00000339775, ENST00000348354, ENST00000471860
Gene coordinates (GRCh38): 21:17593653-17612947
HGNC Alias: ANA, ANA/BTG3, APRO4, tob55
HGNC ID: HGNC:1132
HGNC Symbol: BTG3
NCBI gene: 10950
RefSeq mRNA: NM_001130914, NM_006806
Sequence:CAGGGCCCTTGATAAGGTTACCTCTGATTATCATTCAGGATCCTCTTCTTCAGAT
GAAGAAACAAGTAAGGAAATGGAAGTGAAACCCAGTTCGGTGACTGCAGCCGCAA
GTCCTGTGTACCAGATTTCAGAACTTATATTTCCACCTCTTCCAATGTGGCACCC
TTTGCCCAGAAAAAAGCCAGGAATGTATCGAGGGAATGGCCATCAGAATCACTAT
CCTCCTCCTGTTCCATTTGGTTATCCAAATCAGGGAAGAAAAAATAAACCATATC
GCCCAATTCCAGTGACATGGGTACCTCCTCCTGGAATGCATTGTGACCGGAATCA
CTGGATTAATCCTCACATGTTAGCACCTCACTAACTTCGTTTTTGATTGTGTTGG
TGTCATGTTGAGAAAAAGG
Product name: hBTG3 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08004-1
Sigma Product ID: EHU080041
Species: Homo sapiens
Ensembl Gene ID: ENSG00000154640
Ensembl Transcript ID: ENST00000339775, ENST00000348354, ENST00000471860
Gene coordinates (GRCh38): 21:17593653-17612947
HGNC Alias: ANA, ANA/BTG3, APRO4, tob55
HGNC ID: HGNC:1132
HGNC Symbol: BTG3
NCBI gene: 10950
RefSeq mRNA: NM_001130914, NM_006806
Sequence:CAGGGCCCTTGATAAGGTTACCTCTGATTATCATTCAGGATCCTCTTCTTCAGAT
GAAGAAACAAGTAAGGAAATGGAAGTGAAACCCAGTTCGGTGACTGCAGCCGCAA
GTCCTGTGTACCAGATTTCAGAACTTATATTTCCACCTCTTCCAATGTGGCACCC
TTTGCCCAGAAAAAAGCCAGGAATGTATCGAGGGAATGGCCATCAGAATCACTAT
CCTCCTCCTGTTCCATTTGGTTATCCAAATCAGGGAAGAAAAAATAAACCATATC
GCCCAATTCCAGTGACATGGGTACCTCCTCCTGGAATGCATTGTGACCGGAATCA
CTGGATTAATCCTCACATGTTAGCACCTCACTAACTTCGTTTTTGATTGTGTTGG
TGTCATGTTGAGAAAAAGG

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.