Search our product database

Search options:
Product name: hNCL €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08043-1
Sigma Product ID: EHU080431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000115053
Ensembl Transcript ID: ENST00000322723, ENST00000356936, ENST00000461347
Gene coordinates (GRCh38): 2:231453531-231483641
HGNC Alias: C23, Nsr1
HGNC ID: HGNC:7667
HGNC Symbol: NCL
NCBI gene: 4691
RefSeq mRNA: NM_005381
Sequence:GGGCGATCTATTTCCCTGTACTATACTGGAGAGAAAGGTCAAAATCAAGACTATA
GAGGTGGAAAGAATAGCACTTGGAGTGGTGAATCAAAAACTCTGGTTTTAAGCAA
CCTCTCCTACAGTGCAACAGAAGAAACTCTTCAGGAAGTATTTGAGAAAGCAACT
TTTATCAAAGTACCCCAGAACCAAAATGGCAAATCTAAAGGGTATGCATTTATAG
AGTTTGCTTCATTCGAAGACGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGA
AATTGAGGGCAGAGCAATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAAT
GCCAGAAGCCAGCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCTGAGGATACCA
CTGAAGAGACATTAAAGGAGTCATTTGACGGCTCCGTTCGGGCAAGGATAGTTA
Product name: hNCL €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08043-1
Sigma Product ID: EHU080431
Species: Homo sapiens
Ensembl Gene ID: ENSG00000115053
Ensembl Transcript ID: ENST00000322723, ENST00000356936, ENST00000461347
Gene coordinates (GRCh38): 2:231453531-231483641
HGNC Alias: C23, Nsr1
HGNC ID: HGNC:7667
HGNC Symbol: NCL
NCBI gene: 4691
RefSeq mRNA: NM_005381
Sequence:GGGCGATCTATTTCCCTGTACTATACTGGAGAGAAAGGTCAAAATCAAGACTATA
GAGGTGGAAAGAATAGCACTTGGAGTGGTGAATCAAAAACTCTGGTTTTAAGCAA
CCTCTCCTACAGTGCAACAGAAGAAACTCTTCAGGAAGTATTTGAGAAAGCAACT
TTTATCAAAGTACCCCAGAACCAAAATGGCAAATCTAAAGGGTATGCATTTATAG
AGTTTGCTTCATTCGAAGACGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGA
AATTGAGGGCAGAGCAATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAAT
GCCAGAAGCCAGCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCTGAGGATACCA
CTGAAGAGACATTAAAGGAGTCATTTGACGGCTCCGTTCGGGCAAGGATAGTTA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.