Search our product database

Search options:
Product name: hMORF4L2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08186-1
Sigma Product ID: EHU081861
Species: Homo sapiens
Ensembl Gene ID: ENSG00000123562
Ensembl Transcript ID: ENST00000360458, ENST00000422154, ENST00000423833, ENST00000433176, ENST00000441076, ENST00000451301
Gene coordinates (GRCh38): X:103675496-103688158
HGNC Alias: KIAA0026, MRGX
HGNC ID: HGNC:16849
HGNC Symbol: MORF4L2
NCBI gene: 9643
RefSeq mRNA: NM_001142418, NM_001142419, NM_001142420, NM_001142421, NM_001142422, NM_001142423, NM_001142424, NM_001142425, NM_001142426, NM_001142427, NM_001142428, NM_001142429, NM_001142430, NM_001142431, NM_001142432, NM_012286
Sequence:TTGAAAGTGAGGAGGCGTTTAAGAATAGAATGGAGGTTAAAGTGAAGATTCCTGA
AGAATTAAAACCATGGCTTGTTGAGGACTGGGACTTAGTTACCAGGCAGAAGCAG
CTGTTTCAACTCCCTGCCAAGAAAAATGTAGATGCAATTCTGGAGGAGTATGCAA
ATTGCAAGAAATCGCAGGGAAATGTTGATAATAAGGAATATGCGGTTAATGAAGT
TGTGGCAGGAATAAAAGAATATTTCAATGTGATGTTGGGCACTCAGCTGCTCTAC
AAATTTGAGAGGCCCCAGTATGCTGAAATCCTCTTGGCTCACCCTGATGCTCCAA
TGTCCCAGGTTTATGGAGCACCACACCTACTGAGATTATTTGTAAGAATTGGAGC
AATGTTGGCCTATACGCCCCTTGATGAGAAAAGCCTTGCATTATTGTTGGGCT
Product name: hMORF4L2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08186-1
Sigma Product ID: EHU081861
Species: Homo sapiens
Ensembl Gene ID: ENSG00000123562
Ensembl Transcript ID: ENST00000360458, ENST00000422154, ENST00000423833, ENST00000433176, ENST00000441076, ENST00000451301
Gene coordinates (GRCh38): X:103675496-103688158
HGNC Alias: KIAA0026, MRGX
HGNC ID: HGNC:16849
HGNC Symbol: MORF4L2
NCBI gene: 9643
RefSeq mRNA: NM_001142418, NM_001142419, NM_001142420, NM_001142421, NM_001142422, NM_001142423, NM_001142424, NM_001142425, NM_001142426, NM_001142427, NM_001142428, NM_001142429, NM_001142430, NM_001142431, NM_001142432, NM_012286
Sequence:TTGAAAGTGAGGAGGCGTTTAAGAATAGAATGGAGGTTAAAGTGAAGATTCCTGA
AGAATTAAAACCATGGCTTGTTGAGGACTGGGACTTAGTTACCAGGCAGAAGCAG
CTGTTTCAACTCCCTGCCAAGAAAAATGTAGATGCAATTCTGGAGGAGTATGCAA
ATTGCAAGAAATCGCAGGGAAATGTTGATAATAAGGAATATGCGGTTAATGAAGT
TGTGGCAGGAATAAAAGAATATTTCAATGTGATGTTGGGCACTCAGCTGCTCTAC
AAATTTGAGAGGCCCCAGTATGCTGAAATCCTCTTGGCTCACCCTGATGCTCCAA
TGTCCCAGGTTTATGGAGCACCACACCTACTGAGATTATTTGTAAGAATTGGAGC
AATGTTGGCCTATACGCCCCTTGATGAGAAAAGCCTTGCATTATTGTTGGGCT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.