Search our product database

Search options:
Product name: hFMR1 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08213-1
Sigma Product ID: EHU082131
Species: Homo sapiens
Ensembl Gene ID: ENSG00000102081
Ensembl Transcript ID: ENST00000218200, ENST00000370470, ENST00000370471, ENST00000370475, ENST00000370477, ENST00000439526, ENST00000440235, ENST00000616382, ENST00000616614, ENST00000620828, ENST00000621453, ENST00000643620
Gene coordinates (GRCh38): X:147911951-147951125
HGNC Alias: FMRP, FRAXA, MGC87458, POF, POF1
HGNC ID: HGNC:3775
HGNC Symbol: FMR1
NCBI gene: 2332
RefSeq mRNA: NM_001185075, NM_001185076, NM_001185081, NM_001185082, NM_002024
RefSeq ncRNA: NR_033699, NR_033700
Sequence:CACCTCAAAGCGAGCACATATGCTGATTGACATGCACTTTCGGAGTCTGCGCACT
AAGTTGTCTCTGATAATGAGAAATGAAGAAGCTAGTAAGCAGCTGGAGAGTTCAA
GGCAGCTTGCCTCGAGATTTCATGAACAGTTTATCGTAAGAGAAGATCTGATGGG
TCTAGCTATTGGTACTCATGGTGCTAATATTCAGCAAGCTAGAAAAGTACCTGGG
GTCACTGCTATTGATCTAGATGAAGATACCTGCACATTTCATATTTATGGAGAGG
ATCAGGATGCAGTGAAAAAAGCTAGAAGCTTTCTCGAATTTGCTGAAGATGTAAT
ACAAGTTCCAAGGAACTTAGTAGGCAAAGTAATAGGAAAAAATGGAAAGCTGATT
CAGGAGATTGTGGACAAGTCAGGAGTTGTGAGGGTGAGGATTGAGGCTGAAA
Product name: hFMR1 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08213-1
Sigma Product ID: EHU082131
Species: Homo sapiens
Ensembl Gene ID: ENSG00000102081
Ensembl Transcript ID: ENST00000218200, ENST00000370470, ENST00000370471, ENST00000370475, ENST00000370477, ENST00000439526, ENST00000440235, ENST00000616382, ENST00000616614, ENST00000620828, ENST00000621453, ENST00000643620
Gene coordinates (GRCh38): X:147911951-147951125
HGNC Alias: FMRP, FRAXA, MGC87458, POF, POF1
HGNC ID: HGNC:3775
HGNC Symbol: FMR1
NCBI gene: 2332
RefSeq mRNA: NM_001185075, NM_001185076, NM_001185081, NM_001185082, NM_002024
RefSeq ncRNA: NR_033699, NR_033700
Sequence:CACCTCAAAGCGAGCACATATGCTGATTGACATGCACTTTCGGAGTCTGCGCACT
AAGTTGTCTCTGATAATGAGAAATGAAGAAGCTAGTAAGCAGCTGGAGAGTTCAA
GGCAGCTTGCCTCGAGATTTCATGAACAGTTTATCGTAAGAGAAGATCTGATGGG
TCTAGCTATTGGTACTCATGGTGCTAATATTCAGCAAGCTAGAAAAGTACCTGGG
GTCACTGCTATTGATCTAGATGAAGATACCTGCACATTTCATATTTATGGAGAGG
ATCAGGATGCAGTGAAAAAAGCTAGAAGCTTTCTCGAATTTGCTGAAGATGTAAT
ACAAGTTCCAAGGAACTTAGTAGGCAAAGTAATAGGAAAAAATGGAAAGCTGATT
CAGGAGATTGTGGACAAGTCAGGAGTTGTGAGGGTGAGGATTGAGGCTGAAA

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.