Search our product database

Search options:
Product name: hATG5 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08578-1
Sigma Product ID: EHU085781
Species: Homo sapiens
Ensembl Gene ID: ENSG00000057663
Ensembl Transcript ID: ENST00000343245, ENST00000360666, ENST00000369070, ENST00000369076, ENST00000475645, ENST00000635758, ENST00000646025
Gene coordinates (GRCh38): 6:106045423-106325791
HGNC Alias: APG5, APG5L, ASP, hAPG5
HGNC ID: HGNC:589
HGNC Symbol: ATG5
NCBI gene: 9474
RefSeq mRNA: NM_001286106, NM_001286107, NM_001286108, NM_001286111, NM_004849
Sequence:CAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGAAGTTTGTCCTTCTGC
TATTGATCCTGAAGATGGGGAAAAAAAGAATCAAGTGATGATTCATGGAATTGAG
CCAATGTTGGAAACACCTCTGCAGTGGCTGAGTGAACATCTGAGCTACCCGGATA
ATTTTCTTCATATTAGTATCATCCCACAGCCAACAGATTGAAGGATCAACTATTT
GCCTGAACAGAATCATCCTTAAATGGGATTTATCAGAGCATGTCACCCTTTTGCT
TCAATCAGGTTTGGTGGAGGCAACCTGACCAGAAACACTTCGCTGCTGCAAGCCA
GACAGGAAAAAGATTCCATGTCAGATAAGGCAACTGGGCTGGTCTTACTTTGCAT
CACCTCTGCTTTCCTC
Product name: hATG5 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08578-1
Sigma Product ID: EHU085781
Species: Homo sapiens
Ensembl Gene ID: ENSG00000057663
Ensembl Transcript ID: ENST00000343245, ENST00000360666, ENST00000369070, ENST00000369076, ENST00000475645, ENST00000635758, ENST00000646025
Gene coordinates (GRCh38): 6:106045423-106325791
HGNC Alias: APG5, APG5L, ASP, hAPG5
HGNC ID: HGNC:589
HGNC Symbol: ATG5
NCBI gene: 9474
RefSeq mRNA: NM_001286106, NM_001286107, NM_001286108, NM_001286111, NM_004849
Sequence:CAGATGGACAGTTGCACACACTAGGAGATCTCCTCAAAGAAGTTTGTCCTTCTGC
TATTGATCCTGAAGATGGGGAAAAAAAGAATCAAGTGATGATTCATGGAATTGAG
CCAATGTTGGAAACACCTCTGCAGTGGCTGAGTGAACATCTGAGCTACCCGGATA
ATTTTCTTCATATTAGTATCATCCCACAGCCAACAGATTGAAGGATCAACTATTT
GCCTGAACAGAATCATCCTTAAATGGGATTTATCAGAGCATGTCACCCTTTTGCT
TCAATCAGGTTTGGTGGAGGCAACCTGACCAGAAACACTTCGCTGCTGCAAGCCA
GACAGGAAAAAGATTCCATGTCAGATAAGGCAACTGGGCTGGTCTTACTTTGCAT
CACCTCTGCTTTCCTC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.