Search our product database

Search options:
Product name: hDCTN2 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08658-1
Sigma Product ID: EHU086581
Species: Homo sapiens
Ensembl Gene ID: ENSG00000175203
Ensembl Transcript ID: ENST00000434715, ENST00000543672, ENST00000548249, ENST00000549394
Gene coordinates (GRCh38): 12:57530102-57547331
HGNC Alias: DCTN-50, RBP50
HGNC ID: HGNC:2712
HGNC Symbol: DCTN2
NCBI gene: 10540
RefSeq mRNA: NM_001261412, NM_001261413, NM_001348065, NM_001348066, NM_006400
RefSeq ncRNA: NR_145419
Sequence:GAACTTGAAAAGCGCCTGACAGAGCTGGAGACAGCTGTACGTTGTGATCAGGATG
CTCAGAATCCCCTTTCTGCAGGTCTACAGGGAGCCTGTCTCATGGAGACTGTAGA
GCTGTTGCAAGCAAAGGTGAGCGCCCTAGACCTTGCAGTTTTGGATCAAGTGGAG
GCTCGGCTACAGAGTGTCCTGGGAAAGGTGAACGAGATTGCCAAGCATAAAGCCT
CTGTAGAAGATGCAGATACACAAAGCAAGGTGCACCAGCTATATGAAACTATACA
GCGCTGGAGCCCCATTGCCTCCACCCTCCCTGAGCTGGTGCAGAGACTTGTCACC
ATCAAGCAGCTGCACGAGCAAGCCATGCAGTTTGGTCAGCTCCTGACACACTTGG
ATACCACCCAGCAGAT
Product name: hDCTN2 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08658-1
Sigma Product ID: EHU086581
Species: Homo sapiens
Ensembl Gene ID: ENSG00000175203
Ensembl Transcript ID: ENST00000434715, ENST00000543672, ENST00000548249, ENST00000549394
Gene coordinates (GRCh38): 12:57530102-57547331
HGNC Alias: DCTN-50, RBP50
HGNC ID: HGNC:2712
HGNC Symbol: DCTN2
NCBI gene: 10540
RefSeq mRNA: NM_001261412, NM_001261413, NM_001348065, NM_001348066, NM_006400
RefSeq ncRNA: NR_145419
Sequence:GAACTTGAAAAGCGCCTGACAGAGCTGGAGACAGCTGTACGTTGTGATCAGGATG
CTCAGAATCCCCTTTCTGCAGGTCTACAGGGAGCCTGTCTCATGGAGACTGTAGA
GCTGTTGCAAGCAAAGGTGAGCGCCCTAGACCTTGCAGTTTTGGATCAAGTGGAG
GCTCGGCTACAGAGTGTCCTGGGAAAGGTGAACGAGATTGCCAAGCATAAAGCCT
CTGTAGAAGATGCAGATACACAAAGCAAGGTGCACCAGCTATATGAAACTATACA
GCGCTGGAGCCCCATTGCCTCCACCCTCCCTGAGCTGGTGCAGAGACTTGTCACC
ATCAAGCAGCTGCACGAGCAAGCCATGCAGTTTGGTCAGCTCCTGACACACTTGG
ATACCACCCAGCAGAT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.