Search our product database

Search options:
Product name: hPICALM €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08800-1
Sigma Product ID: EHU088001
Species: Homo sapiens
Ensembl Gene ID: ENSG00000073921
Ensembl Transcript ID: ENST00000356360, ENST00000393346, ENST00000526033, ENST00000528398, ENST00000532317, ENST00000630913
Gene coordinates (GRCh38): 11:85957684-86069882
HGNC Alias: CALM, CLTH
HGNC ID: HGNC:15514
HGNC Symbol: PICALM
NCBI gene: 8301
RefSeq mRNA: NM_001008660, NM_001206946, NM_001206947, NM_007166
Sequence:TTCCTCAAAGTTGCAGAGCAAGTTGGAATTGACAGAGGTGATATACCAGACCTTT
CACAGGCCCCTAGCAGTCTTCTTGATGCTTTGGAACAACATTTAGCTTCCTTGGA
AGGAAAGAAAATCAAAGATTCTACAGCTGCAAGCAGGGCAACTACACTTTCCAAT
GCAGTGTCTTCCCTGGCAAGCACTGGTCTATCTCTGACCAAAGTGGATGAAAGGG
AAAAGCAGGCAGCATTAGAGGAAGAACAGGCACGTTTGAAAGCTTTAAAGGAACA
GCGCCTAAAAGAACTTGCAAAGAAACCTCATACCTCTTTAACAACTGCAGCCTCT
CCTGTATCCACCTCAGCAGGAGGGATAATGACTGCACCAGCCATTGACATATTTT
CTACCCCTAGTTCTTCTAACAGCACATCAAAGCTGCCCAATGATC
Product name: hPICALM €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08800-1
Sigma Product ID: EHU088001
Species: Homo sapiens
Ensembl Gene ID: ENSG00000073921
Ensembl Transcript ID: ENST00000356360, ENST00000393346, ENST00000526033, ENST00000528398, ENST00000532317, ENST00000630913
Gene coordinates (GRCh38): 11:85957684-86069882
HGNC Alias: CALM, CLTH
HGNC ID: HGNC:15514
HGNC Symbol: PICALM
NCBI gene: 8301
RefSeq mRNA: NM_001008660, NM_001206946, NM_001206947, NM_007166
Sequence:TTCCTCAAAGTTGCAGAGCAAGTTGGAATTGACAGAGGTGATATACCAGACCTTT
CACAGGCCCCTAGCAGTCTTCTTGATGCTTTGGAACAACATTTAGCTTCCTTGGA
AGGAAAGAAAATCAAAGATTCTACAGCTGCAAGCAGGGCAACTACACTTTCCAAT
GCAGTGTCTTCCCTGGCAAGCACTGGTCTATCTCTGACCAAAGTGGATGAAAGGG
AAAAGCAGGCAGCATTAGAGGAAGAACAGGCACGTTTGAAAGCTTTAAAGGAACA
GCGCCTAAAAGAACTTGCAAAGAAACCTCATACCTCTTTAACAACTGCAGCCTCT
CCTGTATCCACCTCAGCAGGAGGGATAATGACTGCACCAGCCATTGACATATTTT
CTACCCCTAGTTCTTCTAACAGCACATCAAAGCTGCCCAATGATC

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.