Search our product database

Search options:
Product name: hZNF691 €124.00 / 20 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08806-1
Sigma Product ID: EHU088061
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164011
Ensembl Transcript ID: ENST00000372502, ENST00000372503, ENST00000372504, ENST00000372506, ENST00000372507, ENST00000372508, ENST00000630961
Gene coordinates (GRCh38): 1:42846573-42852477
HGNC Alias: Zfp691
HGNC ID: HGNC:28028
HGNC Symbol: ZNF691
NCBI gene: 51058
RefSeq mRNA: NM_001242739, NM_015911
Sequence:AGGCAGATGAGAAGCCCTTTATATGTGCCCAGTGTGGCAAAACCTTCAATAATAC
CTCCAACCTGAGAACACACCAGCGGATCCACACTGGTGAGAAGCCTTACAAGTGT
TCTGAATGTGGCAAGAGCTTCTCGAGAAGCTCCAACCGCATCCGGCACGAGCGGA
TCCACCTGGAAGAGAAACACTACAAATGCCCCAAGTGCCAGGAGAGCTTTCGGCG
GCGCTCAGACCTCACCACGCACCAGCAAGATCACCTAGGCAAGCGGCCATACCGC
TGTGACATCTGTGGCAAGAGCTTCAGCCAGAGTGCCACGCTAGCTGTGCATCACC
GGACCCACCTGGAGCCAGCACCCTACATCTGCTGTGAGTGTGGGAAGAGCTTCAG
CAACAGCTCCAGCTT
Product name: hZNF691 €221.00 / 50 µg DetailsClose
Category: Human esiRNA
Catalog No: HU-08806-1
Sigma Product ID: EHU088061
Species: Homo sapiens
Ensembl Gene ID: ENSG00000164011
Ensembl Transcript ID: ENST00000372502, ENST00000372503, ENST00000372504, ENST00000372506, ENST00000372507, ENST00000372508, ENST00000630961
Gene coordinates (GRCh38): 1:42846573-42852477
HGNC Alias: Zfp691
HGNC ID: HGNC:28028
HGNC Symbol: ZNF691
NCBI gene: 51058
RefSeq mRNA: NM_001242739, NM_015911
Sequence:AGGCAGATGAGAAGCCCTTTATATGTGCCCAGTGTGGCAAAACCTTCAATAATAC
CTCCAACCTGAGAACACACCAGCGGATCCACACTGGTGAGAAGCCTTACAAGTGT
TCTGAATGTGGCAAGAGCTTCTCGAGAAGCTCCAACCGCATCCGGCACGAGCGGA
TCCACCTGGAAGAGAAACACTACAAATGCCCCAAGTGCCAGGAGAGCTTTCGGCG
GCGCTCAGACCTCACCACGCACCAGCAAGATCACCTAGGCAAGCGGCCATACCGC
TGTGACATCTGTGGCAAGAGCTTCAGCCAGAGTGCCACGCTAGCTGTGCATCACC
GGACCCACCTGGAGCCAGCACCCTACATCTGCTGTGAGTGTGGGAAGAGCTTCAG
CAACAGCTCCAGCTT

Your Shopping Basket

The basket is empty.


All prices are net. Taxes and shipping costs apply.